ID: 1110636111

View in Genome Browser
Species Human (GRCh38)
Location 13:77768489-77768511
Sequence TCTGATTTACATAAGGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 2, 1: 12, 2: 46, 3: 168, 4: 284}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110636111_1110636121 30 Left 1110636111 13:77768489-77768511 CCCTGGGCCTTATGTAAATCAGA 0: 2
1: 12
2: 46
3: 168
4: 284
Right 1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110636111 Original CRISPR TCTGATTTACATAAGGCCCA GGG (reversed) Intergenic
903959807 1:27049749-27049771 TCTGATTTGCATGGGGCTCAGGG + Intergenic
904343413 1:29852647-29852669 CCTGACTTACATATGGCTCAGGG + Intergenic
905696706 1:39979931-39979953 TTTGATTTGCATAGGGCTCAGGG - Intergenic
907184414 1:52598875-52598897 TCTGATTTGCATAGGGCTCAGGG + Intergenic
907568243 1:55457514-55457536 TCTGATTTGCATAGGGCCCAGGG + Intergenic
908171978 1:61514048-61514070 TCTGATTTAAATATGGCCAAAGG - Intergenic
908438640 1:64131526-64131548 TATCATTTACACAAGGGCCAAGG - Intronic
908650481 1:66327749-66327771 TCTGATCTACCTAATGCACAGGG - Intronic
908761320 1:67514465-67514487 ACTGATGTACATAGGGTCCAGGG - Intergenic
908910019 1:69062370-69062392 TCTGATTTGCATAGGGCTCAGGG + Intergenic
908912744 1:69091505-69091527 TCTGATTTGCATAGGGCTCAGGG - Intergenic
909800278 1:79797548-79797570 TCTGGTTTGCATAGGGCCCAGGG + Intergenic
911070607 1:93829168-93829190 ACTGATTTACTTAGGGCTCAGGG + Intronic
912047682 1:105480687-105480709 TCTGATTTGCATAGGGCTCAGGG - Intergenic
912609411 1:111028176-111028198 TCTGATTTGCATAGGGCCCAGGG - Intergenic
912610002 1:111033212-111033234 TCTGATTTGCATAGTGCCCAGGG - Intergenic
915116781 1:153606389-153606411 TCTGATTTGTATAGGGCTCAGGG - Intergenic
916589007 1:166172225-166172247 TCTGCTTGACCTGAGGCCCAGGG - Intergenic
916771414 1:167912532-167912554 TCTGATTTGCATAGGGTTCAGGG - Intronic
917367430 1:174247760-174247782 TCTGATTTGCATAGGGCTCATGG - Intronic
917769929 1:178266734-178266756 TCTTATTTGCATAGGGCTCAGGG + Intronic
918002643 1:180512300-180512322 TCTGATTTGCGTAGGGCTCAGGG + Intergenic
919216210 1:194559289-194559311 TCTTACTTACATAAAGCCCAAGG - Intergenic
920639742 1:207740916-207740938 TCTGATTTGCATAGGGCTCAGGG - Intergenic
920910655 1:210213399-210213421 TCTGATTTATATAGGGCCCAGGG - Intergenic
922550632 1:226491602-226491624 TCTGATTTGCATAGGGCCCAGGG + Intergenic
922637150 1:227185546-227185568 TCTGATTTGCATAGAGCTCAGGG - Intronic
922849867 1:228723367-228723389 TCTGATTTGCATAGGGCTCAGGG + Intergenic
922887431 1:229030975-229030997 TTTGATTTACGTAGGTCCCAGGG - Intergenic
923458325 1:234185646-234185668 TCTGCTTTACAGAATACCCAGGG + Intronic
924576121 1:245282635-245282657 TCTGATTTGCATAGGGCTTAGGG - Intronic
1063207234 10:3844787-3844809 TTTGGTTTACATATTGCCCATGG - Intergenic
1065353635 10:24817974-24817996 TGGAATTTACATAAGGTCCAGGG - Intergenic
1065462593 10:25984460-25984482 TCTGGTTTGCATAGGGCCCAGGG - Intronic
1065780510 10:29162335-29162357 TCTGATTTGCATAGGGCTTAGGG + Intergenic
1066110046 10:32187750-32187772 TCTGATTTACATAGGGCTCAGGG + Intergenic
1066115090 10:32232756-32232778 ACTGATTTACATAGGGCCCAGGG - Intergenic
1066207618 10:33205258-33205280 TTTGTTTCACATACGGCCCAGGG + Intronic
1066471290 10:35700781-35700803 TCTGGTTTGCATAGGGCTCAGGG - Intergenic
1067304148 10:45044304-45044326 ACTGATTGACATAGGGCCCAGGG + Intergenic
1068161539 10:53271560-53271582 TCTGATTTTCATAGGGCTCAGGG - Intergenic
1068522474 10:58093145-58093167 TCTGATTTACATAGGGCCCAGGG + Intergenic
1069180123 10:65348719-65348741 ATTGATTTACATAGGGCTCAGGG + Intergenic
1069236896 10:66087172-66087194 TTTGATTTAAATTGGGCCCAGGG - Intronic
1069759496 10:70798878-70798900 GCTGATTTACGTGGGGCCCACGG - Intergenic
1071902454 10:90135833-90135855 TTTGATTTGCATAGGGCCCAGGG - Intergenic
1071902877 10:90139776-90139798 TTTGATTTGCATAGGGCCCAGGG - Intergenic
1072677643 10:97480187-97480209 TCTGATTTGCATAGGGCTCGGGG - Intronic
1072909626 10:99488338-99488360 TTTGATTTTCACAAGCCCCAGGG - Intergenic
1073759261 10:106612450-106612472 TCTGATTTGCATAGGGCTTAGGG + Intronic
1073838502 10:107471435-107471457 TCTGATTTCCATAGGGCTCAGGG + Intergenic
1073970085 10:109038122-109038144 ATTGATTTACATAGGGCTCAGGG + Intergenic
1074298799 10:112214743-112214765 TCTGATTTGCAAACGGCACATGG - Intronic
1074350487 10:112732281-112732303 TCTGATTTGCATAAATCCTAAGG - Intronic
1075094676 10:119463159-119463181 TCAGACTTCCATAAGGCCGAGGG - Intergenic
1075366084 10:121891209-121891231 ACTGATTTACATGGGGCTCAGGG + Intronic
1075616197 10:123892132-123892154 TCTGATTTACTTTAGGACCCTGG - Intronic
1080725662 11:34897867-34897889 TCTGATTTTCATAGGGCCCAGGG - Intronic
1080916485 11:36665582-36665604 ACTGATTTACATAGGCCTCAGGG - Intergenic
1081075068 11:38661960-38661982 TCTGAATTACATATGGCTGAGGG - Intergenic
1081189029 11:40080774-40080796 TCTGATTTGCATATGGCTCGGGG - Intergenic
1081832843 11:46128773-46128795 TCTGTATTACATAAAGCACATGG + Intergenic
1083167499 11:60899996-60900018 TCTCATTTCCCTAAGGTCCAAGG + Intronic
1084914858 11:72421148-72421170 TCTGATTTGCATAGGACTCAAGG - Intronic
1085208217 11:74749600-74749622 TCGGACTTACGTAAGGCACAGGG - Intronic
1086058482 11:82675936-82675958 TCTGATTTGCATGGGGCCCAGGG + Intergenic
1086059231 11:82683128-82683150 TCTGATTTGCATAGGGCCCAGGG + Intergenic
1088127253 11:106443465-106443487 TCAGATTTACATAACGTCTATGG - Intergenic
1090324541 11:125873763-125873785 TCTGATTTACATAGGGCCTAGGG - Intergenic
1090632641 11:128663562-128663584 GCTGATTTATTTTAGGCCCATGG - Intergenic
1092337510 12:7646312-7646334 TCTGATTTGCATAGGGCCCAAGG - Intergenic
1092575980 12:9783038-9783060 TCTGATTTCCATAGGGCTCAAGG + Intergenic
1092583528 12:9874127-9874149 TCTGGTTCACAGTAGGCCCAAGG + Intergenic
1093066747 12:14666093-14666115 TCTGATTTATATAGGGCCCAGGG + Intronic
1094289460 12:28830744-28830766 TCTGATGTGCATAGGGCCCATGG - Intergenic
1094476417 12:30844057-30844079 TCTGATTTGTATAGGGCCCAAGG - Intergenic
1094594687 12:31854426-31854448 TATGATTTAGATAAGACCAATGG - Intergenic
1094614342 12:32022706-32022728 TCTGAATTGCATAGGGCTCAGGG - Intergenic
1095573198 12:43705633-43705655 TCTGTTTTTCATACGGCTCAGGG - Intergenic
1096045265 12:48556728-48556750 TCTGATTTGCATAGGGCTTAGGG + Intergenic
1098307423 12:69115956-69115978 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1098720252 12:73888655-73888677 TCTAATTTACATAGGGCACAAGG + Intergenic
1098972680 12:76872664-76872686 TCTGATTTACATAGGGCTTAGGG - Intronic
1100189636 12:92176880-92176902 TCGGATTTACGTAGGGCCCATGG - Intergenic
1100406676 12:94277955-94277977 TCTGATTTGCCTAGGGCTCAGGG - Exonic
1101693393 12:107102009-107102031 TCTGATTTACATCCGGACCAAGG - Intergenic
1101808844 12:108090607-108090629 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1104187587 12:126447700-126447722 TCTGATTTGCATAGGGCTTAGGG - Intergenic
1104351174 12:128045207-128045229 TCTGATTTACACAGGACTCAAGG + Intergenic
1105480578 13:20772306-20772328 TCTGAGCCACATAAGGTCCAAGG - Intronic
1105581387 13:21699794-21699816 TCTTATTTATATAAGGCGCCAGG + Intronic
1106470989 13:30054043-30054065 TCTGTTTTGCATAGGGCTCAGGG + Intergenic
1107080306 13:36367415-36367437 TTTGATTTGCATAGGGCTCAGGG - Intronic
1108397020 13:49999291-49999313 GGTGATTTACATAGGGCCCAGGG - Intronic
1109274348 13:60287022-60287044 TCTGATTTGCACAGGGCTCAGGG - Intergenic
1109682298 13:65768685-65768707 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1110636111 13:77768489-77768511 TCTGATTTACATAAGGCCCAGGG - Intergenic
1110952649 13:81515863-81515885 TTTGATTTGCATAGGGCTCAGGG + Intergenic
1110963382 13:81659090-81659112 TCTGATTTACATAGAGCCCACGG + Intergenic
1111251642 13:85608796-85608818 TCTGATTTGCATAGGGCTAAGGG - Intergenic
1111265963 13:85813751-85813773 TCTGCTTTACATTTGGACCAAGG + Intergenic
1111301284 13:86354128-86354150 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1111340738 13:86882417-86882439 TCTGCTTTGCATAGGGCTCAGGG - Intergenic
1111688154 13:91527321-91527343 TCGGACTTGCATAAGGCCTATGG - Intronic
1112170359 13:96966710-96966732 TCTGATTTGCATAGGGCCCAGGG - Intergenic
1112237684 13:97651013-97651035 TTTGATTTGCATAGGGCTCAGGG + Intergenic
1113129859 13:107023658-107023680 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1113222454 13:108120590-108120612 TTTGATTTGCATAGGGCTCAGGG - Intergenic
1114131473 14:19798298-19798320 TCTGATTTGCATAGGGCCCAGGG + Intronic
1114293561 14:21308811-21308833 TCTGATTTGCATAGGGCTCAGGG + Intronic
1115066799 14:29272415-29272437 TATGTTTTACATAAGGCATAAGG + Intergenic
1115160786 14:30391222-30391244 TTTGATTTGCATCAGTCCCAAGG - Intergenic
1116301130 14:43184769-43184791 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1116904425 14:50391282-50391304 TCTGATTTGCATATGACACATGG - Intronic
1117754926 14:58964879-58964901 ATTGATTTACATAGGGCCCAGGG - Intergenic
1117883539 14:60335512-60335534 ACTGATTTACATAAGGGCTGGGG - Intergenic
1117969769 14:61240327-61240349 TCTGATTTGCACAGGGCTCAGGG + Intronic
1118654100 14:67928459-67928481 TCTGATTTGCATACAGCCCAGGG + Intronic
1119750653 14:77075199-77075221 TCTGATCCACATGTGGCCCATGG - Intergenic
1120395497 14:83962405-83962427 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1120425428 14:84341588-84341610 TCTGATTTGCACAGGGCTCAGGG - Intergenic
1121199948 14:92108477-92108499 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1121578129 14:95005449-95005471 TTTGTTTTACATGAGTCCCATGG + Intergenic
1123508951 15:20976003-20976025 GATGTTTTACATAAGCCCCAAGG - Intergenic
1123566171 15:21549757-21549779 GATGTTTTACATAAGCCCCAAGG - Intergenic
1123574534 15:21654001-21654023 TCTGATTTGCATAGGGCCCAGGG + Intergenic
1123602433 15:21987044-21987066 GATGTTTTACATAAGCCCCAAGG - Intergenic
1123611148 15:22096497-22096519 TCTGATTTGCATAGGGCCCAGGG + Intergenic
1123817445 15:23994323-23994345 TCTGATTTGCGTAGGGCTCAAGG + Intergenic
1125050718 15:35295263-35295285 TCTGATTTCCATAGGGTCCAAGG - Intronic
1125070529 15:35548036-35548058 TCAGATTTGCATAGGGCTCAGGG + Intergenic
1129339054 15:74873148-74873170 TCAGATTTCCCTAGGGCCCACGG - Intronic
1129582732 15:76830197-76830219 TCTGATTTACATGGGGCAGAAGG + Intronic
1130043121 15:80421754-80421776 CCTGAGCTGCATAAGGCCCAAGG - Intronic
1130263939 15:82381584-82381606 TCTGATTTGCACAGGGACCAGGG - Intergenic
1130277091 15:82486007-82486029 TCTGATTTGCACAGGGCCCAGGG + Intergenic
1130469453 15:84213357-84213379 TCTGATTTGCACAGGGCCCAGGG + Intergenic
1130476943 15:84327921-84327943 TCTGATTTGCACAGGGCCCAGGG + Intergenic
1130494822 15:84460209-84460231 TCTGATTTGCACAGGGCCCAGGG - Intergenic
1130535033 15:84778343-84778365 TTTGATTTGCATAGGGCTCAGGG + Intronic
1130591747 15:85217986-85218008 TCTGATTTGCACAGGGCCCAGGG + Intergenic
1130706340 15:86236788-86236810 TCTGATTTGCATAGGGCTCAGGG + Intronic
1131006936 15:88986091-88986113 TCTGGTTTCCATAAGACCCAGGG + Intergenic
1132378882 15:101351938-101351960 TCTCATTTACATAATTTCCATGG + Intronic
1202974540 15_KI270727v1_random:276840-276862 GATGTTTTACATAAGCCCCAAGG - Intergenic
1202983397 15_KI270727v1_random:388253-388275 TCTGATTTGCATAGGGCCCAGGG + Intergenic
1133543143 16:6775820-6775842 ACTGATTTTCATAAGACACATGG - Intronic
1133631347 16:7625065-7625087 TCTGATTTGCATACAGCCCAGGG + Intronic
1133650940 16:7814153-7814175 TCTGATTTGCATGAGGCTCAGGG - Intergenic
1134376365 16:13678534-13678556 TCTGACTTGCATAGGGCTCAGGG + Intergenic
1134659211 16:15971176-15971198 TCTGATTTGCATAGGCCTCAGGG + Intronic
1135458675 16:22621834-22621856 ACTGATTAACTTAAGGACCAGGG - Intergenic
1136088573 16:27902725-27902747 CCAGATTTAAATAACGCCCAAGG - Intronic
1136352367 16:29719294-29719316 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1139096877 16:63715181-63715203 TCTGATTTACATAGGGCACAAGG - Intergenic
1140426767 16:74867644-74867666 TCTGATTTACGTAGCGCCCACGG - Intergenic
1141733634 16:85838602-85838624 TCTGACTTACATAACCACCAGGG - Intergenic
1142495167 17:302396-302418 TTCGATTTACACAAGGTCCAAGG + Intronic
1143326142 17:6099732-6099754 TCTGCGTTCCATAAGGCCCAGGG - Intronic
1143370782 17:6437738-6437760 TCTGATTTCCATAGGGCCCAGGG - Intergenic
1144012353 17:11161746-11161768 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1144127976 17:12220547-12220569 TCTGATTTGCATAGGGCCCAGGG + Intergenic
1144150613 17:12439763-12439785 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1144177388 17:12720242-12720264 ATTGATTTACATAGGTCCCAGGG - Intronic
1144593645 17:16546429-16546451 TTTGATTTGCATAGGGCTCAGGG - Intergenic
1145833636 17:27937373-27937395 TCTGATTTGCATAGGGCTTAGGG - Intergenic
1148723613 17:49772822-49772844 TCTGATTTCCTTTAGACCCAGGG + Intronic
1149046710 17:52254955-52254977 TCTGATTTGCACAGGGCCCAGGG + Intergenic
1149207679 17:54267286-54267308 TTTGATTTGCATAGGGCTCAGGG + Intergenic
1150926860 17:69541340-69541362 TCTGATTTACAAATAGCCCTGGG - Intronic
1151506660 17:74532333-74532355 CCTGATTTGCATAGGGCCCAGGG - Intergenic
1153170526 18:2311155-2311177 TCTAGTTTGCATAAGGCCCAGGG - Intergenic
1154005446 18:10523620-10523642 TCTGGTTTGCATAGGGCCCAGGG + Intergenic
1155613467 18:27695301-27695323 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1155934412 18:31740279-31740301 TCTGATTTGCATAGGGCCCAGGG + Intergenic
1155934980 18:31744413-31744435 TCTGATTTGCACAGGGCCCAGGG + Intergenic
1155943810 18:31825814-31825836 TCTGATTTGCATAGGGCTCAAGG + Intergenic
1156784822 18:40897991-40898013 TCTGATTTACATAGGGCCCAGGG + Intergenic
1157398308 18:47362905-47362927 TCTGATTTAAAAAAGGGCAAAGG - Intergenic
1157891064 18:51418396-51418418 TTTGATTTACATAGGGCCCAGGG - Intergenic
1157927292 18:51780343-51780365 ACTGATTTACTTAGGGCTCATGG - Intergenic
1159156564 18:64590749-64590771 TCTGACTTATTTAAGGCCTATGG - Intergenic
1162689884 19:12420739-12420761 TCAGATTTTTATAAGGGCCAGGG - Intronic
1162864811 19:13537770-13537792 TCTGATTTGCATAGGGCCCAAGG - Intronic
1163070616 19:14837635-14837657 TCTGATTTACATAGGGCCCAGGG - Intergenic
1163349922 19:16770068-16770090 TCTGAGCTCCATAAGGCCAATGG + Intronic
1164061616 19:21680268-21680290 ATTGATTTACATAGGGCCCAGGG - Intergenic
1164064646 19:21705504-21705526 ATTGATTTACATAGGGCCCAGGG + Intergenic
1164397289 19:27877294-27877316 TCTGATTTGCATATGAACCAGGG - Intergenic
1164398338 19:27885661-27885683 CCTGATTTTCATATGACCCAGGG - Intergenic
1164460934 19:28446769-28446791 CCTGATTTGCATAGGGCTCAGGG - Intergenic
1165112479 19:33510445-33510467 TCTGATTTACATAGGGCTCAGGG + Intronic
1165271577 19:34712136-34712158 ATTGATTTACATAGGGCCCAGGG - Intergenic
1165975317 19:39671324-39671346 TCTGGTTTCCATAGGGCCCAGGG - Intergenic
1166411552 19:42558720-42558742 TCTGATTTGCACAGGGCTCAGGG - Intronic
1166439019 19:42794358-42794380 ATTGATTTACATAGGGTCCAGGG + Intronic
1166474021 19:43105130-43105152 ATTGATTTACATAGGGTCCAGGG + Intronic
1166487980 19:43230209-43230231 ATTGATTTACATAGGGTCCAGGG + Intronic
1166494799 19:43292074-43292096 ATTGATTTACATAGGGTCCAGGG + Intergenic
1168183166 19:54677450-54677472 TCTGGTTTGCATAGGGCCCAGGG - Intronic
930621332 2:53646881-53646903 TCTGATTTGCATAGGGCCCAGGG + Intronic
930791185 2:55330529-55330551 ACTGATATACATAAATCCCAAGG + Intronic
930869931 2:56160190-56160212 TCTGATTTGCACAGGGCTCAGGG - Intergenic
931345764 2:61444736-61444758 TCTGATTTGCATAGGGCTCAGGG - Intronic
931687669 2:64808341-64808363 TGACATTTACATAGGGCCCAGGG - Intergenic
934028967 2:88024594-88024616 TCTGGTTTCCATAGGGCCCAGGG + Intergenic
934131502 2:88953311-88953333 TCTGATTTGCATAGGGCTTAGGG - Intergenic
934135775 2:88995113-88995135 TCTGATTTGCAAAGGGCTCAAGG - Intergenic
934147026 2:89104964-89104986 TCTGATTTATATAGGGCTCTAGG - Intergenic
934166115 2:89295961-89295983 TCTGATTTGCACAGGGCTCAGGG + Intergenic
934201160 2:89886495-89886517 TCTGATTTGCACAGGGCTCAGGG - Intergenic
934222240 2:90095631-90095653 TCTGATTTATATAGGGCTCTAGG + Intergenic
934233175 2:90205401-90205423 TCTGATTTGCATAGGGCTCAGGG + Intergenic
934234540 2:90218662-90218684 TCTGATTTGCAAAGGGCTCAAGG + Intergenic
934800527 2:97152861-97152883 TCTGATGTAAATAAGTACCATGG - Intronic
935162079 2:100537937-100537959 TCTGATTTGCATAGGGCTCAGGG + Intergenic
936229627 2:110688750-110688772 TCTTATTTGCCTAGGGCCCAGGG - Intergenic
936685363 2:114821138-114821160 TCTGATTTGCATAGGGCTCACGG + Intronic
937126054 2:119475789-119475811 TCTGATTTTCAGAAGGCTCCGGG + Intronic
937169736 2:119854063-119854085 TCTGATTTGCATAGGGCTCAGGG + Intronic
937838462 2:126498190-126498212 TCTGATTTACACAGGGCCCAGGG + Intergenic
937863959 2:126733931-126733953 TCTGCTTTACTCAAAGCCCATGG - Intergenic
938273773 2:129998191-129998213 TGTGAATTACACAAGGCCCCTGG + Intergenic
938278126 2:130045723-130045745 TGTGAATTACACAAGGCCCCTGG + Intergenic
938329096 2:130436524-130436546 TGTGAATTACACAAGGCCCCTGG + Intergenic
938360849 2:130684969-130684991 TGTGAATTACACAAGGCCCCTGG - Intergenic
938437253 2:131291662-131291684 TGTGAATTACACAAGGCCCCTGG - Intronic
938442435 2:131347924-131347946 TGTGAATTACACAAGGCCCCTGG - Intronic
939133899 2:138271776-138271798 TCTGATTTGCATAGGACTCAGGG - Intergenic
939477689 2:142707537-142707559 TTTGATTTGCATAGGACCCAGGG + Intergenic
940702752 2:157066414-157066436 TCTGATATACAGTAGGCTCATGG - Intergenic
942237712 2:173928302-173928324 TCTGACTTACATGAGGGCCTGGG - Intronic
943398608 2:187374870-187374892 TTTGCTTTAAATAAGCCCCAGGG - Intronic
943446010 2:187988654-187988676 CCTGATTTGCATAGAGCCCAGGG - Intergenic
943446740 2:187995780-187995802 TCTGATTTGCATAGGGCTCTGGG - Intergenic
943618360 2:190119358-190119380 TCTGATTTGCATAGGGCTCAGGG + Intronic
944477873 2:200125644-200125666 TCTGATTTATACAGGGCTCAAGG + Intergenic
944748070 2:202678345-202678367 TTTGATTTGCATAGGGCTCAGGG + Intronic
945954313 2:216071382-216071404 TCTGATTAACAGAAGGCACATGG + Intronic
947267540 2:228300059-228300081 TTTGATTTGCATAGGGCTCAGGG + Intergenic
947268722 2:228309022-228309044 TTTGATTTGCATAGGGCTCAGGG + Intergenic
947282729 2:228473496-228473518 TCTGATTTACACAGGGCCCAAGG + Intergenic
947598460 2:231429236-231429258 TTTGATTTGCATAGGGCTCAGGG + Intergenic
1169254870 20:4089099-4089121 TCTGAGATACAGAAAGCCCAGGG + Intergenic
1170101161 20:12701021-12701043 TCTGATTTGCATAGGGCCCAGGG - Intergenic
1170421905 20:16201385-16201407 TCTGATTTGCATAGGACTCAGGG - Intergenic
1170510254 20:17069030-17069052 TCAGAGTTACATAATGACCAAGG + Intergenic
1172889009 20:38250695-38250717 TCTGATTTGCATAGGGCTCAAGG + Intronic
1173467653 20:43296053-43296075 TCTGATTTGCATAAGGCTCAGGG - Intergenic
1173599442 20:44282837-44282859 GCTGATGTACAAAAGGGCCATGG - Intergenic
1174056948 20:47804531-47804553 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1174489769 20:50884628-50884650 TCTGGTTTTCATATGGCACAAGG + Intergenic
1174660567 20:52209283-52209305 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1175054266 20:56184135-56184157 TCTGACTGACCCAAGGCCCATGG - Intergenic
1176675398 21:9772517-9772539 TCTGATTTCCTTAGGGCTCAGGG + Intergenic
1177716124 21:24841437-24841459 TCTGATTTGCATAGGGCCCAAGG + Intergenic
1177905735 21:26968744-26968766 TCTGAAATACATCAGGACCAGGG + Intergenic
1178325409 21:31641594-31641616 TCTGATTTGCACAGGGCTCAGGG + Intergenic
1179161804 21:38905503-38905525 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1181376207 22:22460158-22460180 TCTGATTTGCAAAGGGCCCAGGG + Intergenic
1181376793 22:22465156-22465178 TCTGATTTGCACAGGGCCCAGGG + Intergenic
1181641909 22:24205874-24205896 TTTGATCTGCATAAGGCCCAGGG + Intergenic
1181682859 22:24507913-24507935 TCTGATTTGCATAGGGCCCAGGG - Intronic
1182568782 22:31220433-31220455 TCTGTTTTGCACCAGGCCCAAGG + Intronic
1182670071 22:31988364-31988386 TCTGGTCTGCATAGGGCCCAGGG + Intergenic
1183037673 22:35152391-35152413 TCTGATTTGCATAGGCCTCAGGG + Intergenic
1183282676 22:36940760-36940782 TCTGATTTGCATAGGGCTCAGGG + Intergenic
949669186 3:6378516-6378538 TCTAATTTGCACAAGGCCCAGGG - Intergenic
949684562 3:6553418-6553440 TTTGATTTGCATAGGGCTCAGGG - Intergenic
949751182 3:7354351-7354373 TCTGACTTACAATGGGCCCATGG + Intronic
951244525 3:20325127-20325149 TCTGCTTTCCATAAAGCCCTTGG + Intergenic
952100744 3:30010298-30010320 ACTGATCTACAGAAAGCCCAAGG - Intronic
952497555 3:33929135-33929157 GCTAATGTATATAAGGCCCAGGG - Intergenic
953076614 3:39577609-39577631 TCTGGTTTGCATAGGGCTCAGGG + Intergenic
953760708 3:45684632-45684654 TTTGATTTACATAGAGCCCAAGG + Exonic
954085392 3:48240192-48240214 TCTGGTTTCCATAGGGCTCAGGG + Intergenic
954456287 3:50601421-50601443 TCTGCCCTACACAAGGCCCAGGG + Intergenic
954651572 3:52167399-52167421 TTTGATTTACATAGGACCCCGGG - Intergenic
955581025 3:60422560-60422582 TCTGATTTACATAAACTCAAGGG + Intronic
956327186 3:68066917-68066939 ACAGATTTCCATAAGGCACAGGG + Intronic
957274129 3:78068305-78068327 TCTGATTTGCATAGGTCTCAGGG + Intergenic
957478543 3:80759049-80759071 TCTGATTTACATAGGGCCCATGG + Intergenic
958262528 3:91398266-91398288 TCTGCCTTACATCAGGCACAGGG + Intergenic
958574262 3:95927159-95927181 TCTGATTTGCATAGGGCTCAGGG + Intergenic
959341336 3:105135341-105135363 TCTGATTTGTATAGGGCTCAGGG - Intergenic
959822845 3:110757016-110757038 TCTGATTTGCATAGGGCTTAGGG - Intergenic
960337715 3:116438781-116438803 TCAGATTTACATAACGTCTATGG - Intronic
960682548 3:120264076-120264098 TCTGATTTGCATAGGGCTCAGGG - Intronic
960719973 3:120616264-120616286 TCTGATTTGCACAGGGCTCAGGG + Intergenic
961241775 3:125417515-125417537 TCTGATGGACACAAGGCCCTCGG + Intergenic
962458891 3:135590960-135590982 TCTGATTTGCATAAAGCTCGGGG - Intergenic
962737211 3:138336595-138336617 ATTGATTTACATAGGGCCTAGGG + Intergenic
962744852 3:138389639-138389661 TCCTATTTCCCTAAGGCCCAAGG - Intronic
963174998 3:142288989-142289011 TCTGATTTATGTAGGGCCCATGG - Intergenic
963226424 3:142867102-142867124 TCTGATTTGCATAGGGCCCAGGG - Intronic
963478206 3:145833657-145833679 TCTTCTTTACTTAAAGCCCACGG - Intergenic
964195783 3:154062771-154062793 TCTGATTTGCATAGGGCTCAGGG - Intergenic
965051957 3:163662735-163662757 TCTGCATTCCATAAAGCCCAAGG - Intergenic
965099414 3:164277528-164277550 TCTGATTTGCACAGGGCTCAGGG + Intergenic
965128589 3:164664322-164664344 TCTGATTTATCCAAGGGCCATGG + Intergenic
965819058 3:172666384-172666406 TCTGGTTTGCATAGGGCCCAGGG - Intronic
965820097 3:172676513-172676535 TCTGGTTTGCATAGGGCCCAGGG - Intronic
965930646 3:174038959-174038981 TTTCATTTACATAACTCCCAGGG + Intronic
966083738 3:176040465-176040487 TCTGAGTTTCATAAAGGCCAAGG + Intergenic
966456884 3:180127799-180127821 TCTGATTTGTATAGGGCTCAGGG + Intergenic
967646517 3:191930079-191930101 TCTGAATTACTGAAGGACCAAGG - Intergenic
968005911 3:195242657-195242679 TCTGATCTGCATAGGGCCCAGGG + Intronic
968171998 3:196518226-196518248 TCTGATTTGCATAGAGCCCAAGG - Intergenic
972216327 4:36900788-36900810 TCTGATTTGCATAGGGCTCAGGG - Intergenic
973828678 4:54736187-54736209 TCTGCATTACCTAAGGCCCATGG + Intronic
974223230 4:59003375-59003397 TTTGATTTACATAAAGCCCAAGG - Intergenic
974332211 4:60495603-60495625 TCTGATTTGCATAGGGCCCAGGG + Intergenic
974424495 4:61723523-61723545 TCTGATTTGCATAGGGCCCAGGG + Intronic
974648069 4:64719132-64719154 TCTGATTTGCATAAGGCCCAGGG + Intergenic
974914006 4:68157194-68157216 TCTGATTTGCATAGGACCCAGGG + Intergenic
974933776 4:68389568-68389590 TCTGATTTGTATAGGGCTCAGGG + Intergenic
975019351 4:69467894-69467916 TCTGGTTTCCATACTGCCCAGGG + Intergenic
975310435 4:72897981-72898003 TTTGATTTGCATAGGGCCTAGGG + Intergenic
975730152 4:77329924-77329946 TCTGATTTGCATAGGGCTCAGGG + Intronic
976194955 4:82523322-82523344 TTTGATTTGCATAGGGCTCAGGG + Intronic
976267220 4:83195619-83195641 TCTGATTTGCATAGGGCTCAGGG - Intergenic
976396930 4:84566029-84566051 ATTGATTTACATAAGGCCCAGGG + Intergenic
977751950 4:100620454-100620476 TCTGATTTGCACAGGGCTCAGGG + Intronic
977957722 4:103049632-103049654 TCTGATGTACATATAGACCAGGG - Intronic
978498807 4:109386920-109386942 TCTGATTTGCATAGGGTCCATGG + Intergenic
978522959 4:109635563-109635585 TCTGATTTGCATAGGGCACAGGG - Intronic
979840119 4:125428425-125428447 TGTGACTCACACAAGGCCCAGGG + Intronic
979882981 4:125986174-125986196 TCTGATTTGCATAGGGCTCAGGG - Intergenic
980480092 4:133376931-133376953 TCTGATTTGCATAGGGCTCAGGG + Intergenic
980600842 4:135022251-135022273 TTTGATTTGCATAGGGCCCAGGG - Intergenic
980784655 4:137536720-137536742 TGTGATTGACAAAAGGCCTAAGG - Intergenic
981403362 4:144339727-144339749 TCTGATTTGCATAGGGCTCAGGG + Intergenic
981893954 4:149774581-149774603 TCTGATTTGCATAGGGCTCAGGG - Intergenic
981980364 4:150784576-150784598 TCTGATTTGCATAGGGCTCAGGG - Intronic
982465323 4:155723115-155723137 TCTGTTTTCCATGAGGCCCTTGG - Intronic
982693320 4:158572057-158572079 ATTGATTTACATAGAGCCCAGGG - Intronic
982919133 4:161251996-161252018 TCTGGTTTGCATAGGGCTCAGGG + Intergenic
983043152 4:162954410-162954432 TCTGGTTTGCATAGGGCCCAGGG + Intergenic
983412278 4:167416781-167416803 TCTGATTTACACAGGGCCCAGGG - Intergenic
983413208 4:167424152-167424174 TCTGATTTACCTAGGGCCCAGGG - Intergenic
983452980 4:167929953-167929975 TCTGCTTTTCATAAAGCCCTTGG - Intergenic
983553861 4:169042613-169042635 TCTTATTTACATGAGCCACATGG - Intergenic
983768142 4:171512630-171512652 TCTGATTTGCATAGGGCTCAGGG - Intergenic
984083346 4:175277846-175277868 ACTGATTTACATAGGGCCCAGGG + Intergenic
984367789 4:178821028-178821050 TCTGATTTGCACAGGGCTCAGGG + Intergenic
984448522 4:179869117-179869139 TTTGATTTTAATAATGCCCATGG - Intergenic
984862259 4:184251733-184251755 TCTGATTTGCATAGGGCTCAGGG + Intergenic
985044299 4:185924696-185924718 TCTGATTTGCATAGGGCACAGGG - Intronic
985400152 4:189586180-189586202 TCTGATTTCCATAGGGCTCAGGG - Intergenic
986337422 5:6766020-6766042 TCAGGTTTAAAAAAGGCCCAGGG + Intergenic
986825190 5:11512710-11512732 GCTGATTTACATAGGGCTCCAGG + Intronic
986892938 5:12331312-12331334 TCTAATTTGCATAGGGCTCAGGG - Intergenic
986948535 5:13053229-13053251 TCTTATTTGCACAGGGCCCAGGG - Intergenic
987017504 5:13835656-13835678 TCTGATTTGCATAGGGCTTAGGG - Intronic
987507994 5:18798168-18798190 TCTGATTTGCCTAGGGCTCAGGG + Intergenic
987668379 5:20975406-20975428 TCCGGTTTGCATAGGGCCCAGGG + Intergenic
988016875 5:25570474-25570496 TTTGATTTGCATAGGGCTCAGGG - Intergenic
988196475 5:28012029-28012051 GATGATTTACATAGGGTCCAGGG - Intergenic
988523334 5:31965306-31965328 TCTGATTTGCATAGGGCACAGGG + Intronic
988584988 5:32500440-32500462 TTTGATTTGCATAGGGCTCAGGG - Intergenic
989214289 5:38888158-38888180 TCTGATTTGCATAGGGCTGAGGG + Intronic
989282021 5:39655297-39655319 TCTGATTTACACAGGGCTTAGGG - Intergenic
989297879 5:39850993-39851015 TCTGACTTACATGAGGTCTAGGG + Intergenic
991726613 5:69541861-69541883 TCTGAGTCACGTGAGGCCCAAGG + Intronic
991868344 5:71086013-71086035 TCTGAGTCACGTGAGGCCCAAGG - Intergenic
992818372 5:80468139-80468161 TCAGGTTTACAAAAGGTCCATGG + Intronic
993610788 5:90051866-90051888 TATGATTTACATAATGAACATGG + Intergenic
994089979 5:95801161-95801183 TCTGGTTTGCATAGGGCCCAGGG - Intronic
994646418 5:102474735-102474757 TCTGATTTAAAAATGGCCAAAGG + Intronic
995714902 5:115072751-115072773 TCTGATTTACATAGGGCCCAGGG + Intergenic
995738556 5:115329691-115329713 TCTGATTTGCATAGGACTCAGGG - Intergenic
997230874 5:132242086-132242108 TTTGATTTACACAGGGGCCAGGG - Intronic
998345116 5:141455492-141455514 TCTGATTTGCATAGGGCTCAGGG + Intronic
1000276574 5:159741972-159741994 TTTGATTTGCATAGGGCTCAGGG + Intergenic
1002756425 6:164873-164895 TTGGATTTACTGAAGGCCCATGG - Intergenic
1003255403 6:4470845-4470867 TCTGATTTGCGTAGGGCTCAGGG + Intergenic
1005472667 6:26177435-26177457 TGTGATTTAAATAAGACTCATGG + Intergenic
1006289610 6:33124597-33124619 ATTGATTTACATAGGGCTCAGGG + Intergenic
1006676060 6:35764552-35764574 TCTGATTTGCATAGGGCCCAGGG + Intergenic
1008083732 6:47221847-47221869 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1008258798 6:49339418-49339440 ATTAATTTACATAGGGCCCAGGG - Intergenic
1008561860 6:52731969-52731991 TCTGATTTGCACAGGGCTCAGGG - Intergenic
1008845426 6:55957470-55957492 TCTGATTTGCATAGGGCCCAGGG + Intergenic
1008992891 6:57624611-57624633 TCTGCCTTACATTAGGCACAGGG - Intronic
1009181507 6:60523716-60523738 TCTGCCTTACATCAGGCACAGGG - Intergenic
1009529027 6:64786376-64786398 TCTGATTTGCATAGGGCTCAGGG + Intronic
1009683746 6:66929505-66929527 TCTGATTTGCATAAGGCCCAGGG - Intergenic
1010648579 6:78424235-78424257 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1012792870 6:103722357-103722379 TCTGAATGTCATAAGGCTCATGG - Intergenic
1012989511 6:105910988-105911010 CATAATTTACATAAGGACCAAGG + Intergenic
1013412068 6:109891520-109891542 TCTGACTTACCCAAGGGCCATGG - Intergenic
1014197919 6:118580067-118580089 TCTGATTTGCATAGAGTCCAGGG - Intronic
1015372343 6:132468230-132468252 TCTGTTTTAGATAATGCCAAGGG + Intronic
1015889479 6:137955312-137955334 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1016613816 6:146024515-146024537 TCTGACTTGCATGAGGCCTATGG + Intergenic
1016733184 6:147448491-147448513 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1017428210 6:154344049-154344071 TCTGATTTGCATAGGGCTCAGGG - Intronic
1017863592 6:158422728-158422750 TCAGATTTGCATAGGGCTCAGGG + Intronic
1018190886 6:161308228-161308250 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1018366285 6:163123155-163123177 TCTGATTTGCTTAGGGCCCAGGG + Intronic
1018926263 6:168209125-168209147 TCTGGTTTGCATAAGGCCGAGGG - Intergenic
1020773408 7:12424178-12424200 TCTGATTTGCATAGGGCCCAGGG + Intergenic
1021176998 7:17460725-17460747 TCTGATTTGCATAGGGCCCAGGG + Intergenic
1021946486 7:25732816-25732838 TCTGATTTGCATGGGGCTCAGGG + Intergenic
1022279325 7:28890234-28890256 TCTGATTTGCATAGGGTCCAGGG + Intergenic
1023734000 7:43219016-43219038 TTTGATTTGCATAGGGCTCAGGG + Intronic
1024224970 7:47319593-47319615 TCTAAATCACATAAGGCCCAGGG + Intronic
1024239534 7:47423644-47423666 CCTGATTTCCATATTGCCCAGGG + Intronic
1024770172 7:52713168-52713190 TCTGATTTACATAAGGCCCAGGG - Intergenic
1025009353 7:55383367-55383389 TCTGATTTACATAGGGCCCAGGG + Intronic
1025236064 7:57235647-57235669 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1025859146 7:65310229-65310251 TCTGAGTTGCATTAGGCCAATGG - Intergenic
1026201748 7:68220463-68220485 TCTGATTTACACAGGGCTCACGG - Intergenic
1026369324 7:69683124-69683146 TCTGATTTGTATAGGGCCCAGGG + Intronic
1027502389 7:78969269-78969291 ATTGATTTACATAAGGCCCAGGG - Intronic
1028243565 7:88449582-88449604 TCTGGTTTGCATAGGGCTCAGGG - Intergenic
1028252021 7:88547881-88547903 TCTGATTTATGTAGGGCTCATGG + Intergenic
1028589250 7:92478997-92479019 TCTGATTTGCACAGGGCCCAGGG - Intergenic
1029333883 7:99883581-99883603 TCTGATTTTCATAGGGCCCATGG + Intronic
1030407129 7:109128959-109128981 TCTGGTTTCCATAGGGCCCAGGG + Intergenic
1030782332 7:113617054-113617076 TCTGATTTACATAGGGCCCAAGG - Intergenic
1030830804 7:114218484-114218506 TATTATTTTCATATGGCCCAGGG - Intronic
1031399481 7:121314454-121314476 TGTGATTTACACAAGTTCCAAGG - Intergenic
1031410630 7:121436847-121436869 TCTGATTTGCATAGGACTCAGGG + Intergenic
1031862329 7:126994567-126994589 TAAGATTCACTTAAGGCCCAGGG - Intronic
1033817003 7:145085315-145085337 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1034736163 7:153431317-153431339 TCTGATTTGCATAGTGCTCAGGG - Intergenic
1034880588 7:154759539-154759561 CCGGATTTGCATAAGGCTCAGGG - Intronic
1037262185 8:17021955-17021977 TCTGTTTTACATAATTTCCAGGG - Intergenic
1038096544 8:24318443-24318465 TCCTATTTAAATAAGGCACAGGG - Intronic
1039649922 8:39330233-39330255 TCTAATTTACGTAGGGCCCAGGG + Intergenic
1039713860 8:40087702-40087724 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1040056610 8:43063819-43063841 TCTTTTATACATAAGGCCTATGG + Intronic
1040401719 8:47057151-47057173 TCTGATTTGCATAGGGTCCAGGG + Intergenic
1040673307 8:49718010-49718032 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1040854734 8:51937031-51937053 TCTGATTTACATAGGGCCCAAGG + Intergenic
1041566512 8:59284915-59284937 TCTCATTTAAATAAGACACAGGG + Intergenic
1041741816 8:61164640-61164662 TCTGATTTGCATAGGGCTCAGGG - Intronic
1041831834 8:62163277-62163299 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1042442878 8:68848432-68848454 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1042710922 8:71716317-71716339 TTTGATTTACATAGGGCATAGGG + Intergenic
1044136462 8:88592128-88592150 ACTGATTTACATAGGGCTCAGGG + Intergenic
1046512890 8:115221528-115221550 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1046781795 8:118223296-118223318 TCTCCTATACATTAGGCCCACGG + Intronic
1046950536 8:120015788-120015810 TCTGATTTGCACAGGGCTCAGGG + Intronic
1046997652 8:120542357-120542379 TTTGATTTAAATAAGGCCAGTGG + Intronic
1047284951 8:123479881-123479903 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1047725944 8:127684050-127684072 ACTCATTGACTTAAGGCCCAAGG - Intergenic
1048171464 8:132110603-132110625 TCAGACAAACATAAGGCCCAAGG + Intronic
1050186564 9:2981247-2981269 TCTGGTTTGCACAGGGCCCAGGG - Intergenic
1050950337 9:11583459-11583481 TCTGACTTTCATGAGGCCTAAGG - Intergenic
1051278322 9:15417955-15417977 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1052441326 9:28499425-28499447 TCTCATTTACTTAGGGCCAAAGG - Intronic
1052528044 9:29646712-29646734 TCTTATCTACATCTGGCCCATGG - Intergenic
1052528838 9:29656138-29656160 TCTGATTAACAGAAGGCACAGGG + Intergenic
1052718346 9:32145601-32145623 TCTGGTTTCCATAGGGCCCAGGG - Intergenic
1056508787 9:87283104-87283126 TCTGACTTCCATAAAGGCCATGG + Intergenic
1059086770 9:111311536-111311558 TCTGATTAACAAAAAGCCCAAGG - Intergenic
1060330986 9:122670124-122670146 TTTGATTTACATAGGACTCAGGG - Intergenic
1185862492 X:3592264-3592286 TCTGATTTGCATAGGGCTTAGGG + Intergenic
1186055137 X:5642193-5642215 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1186336446 X:8594395-8594417 ACTGATGTACACAAGCCCCAGGG - Intronic
1186800092 X:13084034-13084056 TCTGATTTGCACAGGGCTCAGGG + Intergenic
1188148944 X:26648995-26649017 TGTGATTTGCATAGGGCCCAGGG + Intergenic
1188149540 X:26654435-26654457 TTTGATTTGCATAGGGCCCAGGG + Intergenic
1188429719 X:30092719-30092741 TTTGATTTGCATAGGGCTCAGGG - Intergenic
1188518724 X:31014558-31014580 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1189027227 X:37408358-37408380 TCTGATTTGCATAGGGCTCAGGG + Intronic
1189234147 X:39474774-39474796 TATGTTATACATCAGGCCCATGG - Intergenic
1189590393 X:42505131-42505153 TCTGATTTGCATAGGGCTCTGGG + Intergenic
1190538796 X:51456518-51456540 TTTGATTTGCATAGGGCCCAGGG - Intergenic
1190539432 X:51461925-51461947 TCTGATTTGCATAAGGCCCAGGG - Intergenic
1191204170 X:57816773-57816795 TCTAATTTGCATAGGGCCCAGGG + Intergenic
1191204860 X:57822866-57822888 TCTGATTTGCATAGGGTCCAGGG + Intergenic
1191889554 X:65926256-65926278 TCTGGTTTGCATAAGGCTCAGGG + Intergenic
1191936213 X:66429719-66429741 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1192765178 X:74132604-74132626 TCTGATTTGGATAGGGCTCAGGG - Intergenic
1192765775 X:74138256-74138278 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1192777503 X:74260246-74260268 TTTGATTTGCATAGGGCTCAGGG - Intergenic
1192840773 X:74853276-74853298 ATTGATTTACATAGGGCTCAGGG + Intronic
1193842441 X:86423491-86423513 TCTGATTTAAAAAGGGCCAAAGG - Intronic
1194104931 X:89757221-89757243 TTTGATTTGCATAGGGCCCAGGG + Intergenic
1194105555 X:89762723-89762745 GTTGATTTACATAGGGCCCAGGG + Intergenic
1194207383 X:91028443-91028465 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1194222562 X:91213706-91213728 TCTGGTTTACATAGGGCCCAGGG + Intergenic
1194476626 X:94366925-94366947 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1194533040 X:95074358-95074380 CCTGATTTGCATAGGGCCCAGGG + Intergenic
1194533648 X:95079586-95079608 CCTGATTTGCATAGGGCCCAGGG + Intergenic
1195336202 X:103857345-103857367 TCTGATTTACATAGGGCCCAGGG + Intergenic
1195372573 X:104193151-104193173 TTTGTTTTGCATAATGCCCATGG + Exonic
1195920407 X:109977895-109977917 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1196232714 X:113242792-113242814 TCTGATGTAAATTAGTCCCAGGG + Intergenic
1196874005 X:120140626-120140648 ATTGATTTACATAGAGCCCAGGG - Intergenic
1197209848 X:123819575-123819597 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1197495733 X:127176913-127176935 TCTTCTTGACATATGGCCCAGGG + Intergenic
1197662395 X:129188272-129188294 TCTGATTTGCACAGGGCTCAGGG + Intergenic
1197799095 X:130330281-130330303 GCTGATTCACATAAGGCACCTGG - Intergenic
1198048079 X:132922473-132922495 TCAGATTTGGATAAGGACCATGG - Intronic
1198633808 X:138673306-138673328 TTTGATTTGCATAGGGCTCAGGG + Intronic
1198837203 X:140817479-140817501 TCTTGTTTGCATAGGGCCCAAGG + Intergenic
1198847768 X:140931220-140931242 TCTGATTTGCATAGGGCTCAGGG - Intergenic
1199018629 X:142848689-142848711 TCTGATTTGCATAGGGCGCAGGG - Intergenic
1199708472 X:150451271-150451293 TTTCCTTGACATAAGGCCCAAGG + Intronic
1200425852 Y:3019664-3019686 TCTGATTCGCACAAGGCTCAGGG + Intergenic
1200456895 Y:3405010-3405032 TTTGATTTGCATAGGGCCCAGGG + Intergenic
1200457519 Y:3410548-3410570 GTTGATTTACATAGGGCCCAGGG + Intergenic
1200553183 Y:4603493-4603515 TCTGATTTGCATAGGGCTCAGGG + Intergenic
1200559091 Y:4677471-4677493 TCGGGTTTACATAGGGCCCAGGG + Intergenic
1201360990 Y:13148625-13148647 ATTGATTTACATAGGACCCAGGG - Intergenic
1201378245 Y:13344826-13344848 TCTGACTCACAGAAGGACCATGG - Intronic
1201938012 Y:19428321-19428343 CTTGATTTACATAAGGCACAAGG + Intergenic
1202060686 Y:20884743-20884765 TCTGATTTCCATAGGGCTCCGGG - Intergenic