ID: 1110636112

View in Genome Browser
Species Human (GRCh38)
Location 13:77768490-77768512
Sequence ATCTGATTTACATAAGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 365
Summary {0: 1, 1: 3, 2: 10, 3: 64, 4: 287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110636112_1110636122 30 Left 1110636112 13:77768490-77768512 CCTGGGCCTTATGTAAATCAGAT 0: 1
1: 3
2: 10
3: 64
4: 287
Right 1110636122 13:77768543-77768565 ACCGCATCCCGCTGCTAACAGGG 0: 1
1: 0
2: 0
3: 7
4: 28
1110636112_1110636121 29 Left 1110636112 13:77768490-77768512 CCTGGGCCTTATGTAAATCAGAT 0: 1
1: 3
2: 10
3: 64
4: 287
Right 1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110636112 Original CRISPR ATCTGATTTACATAAGGCCC AGG (reversed) Intergenic
903494993 1:23759963-23759985 ATCTGATTTTAATAAGGACCTGG - Exonic
903643856 1:24878935-24878957 ATCTGATTTAGATGAGACTCTGG - Intergenic
903709523 1:25312391-25312413 ATCTGATTTAGATGAGACCATGG + Intronic
903717593 1:25380027-25380049 ATCTGATTTAGATGAGACCATGG - Intronic
907184413 1:52598874-52598896 GTCTGATTTGCATAGGGCTCAGG + Intergenic
907568242 1:55457513-55457535 GTCTGATTTGCATAGGGCCCAGG + Intergenic
908910018 1:69062369-69062391 GTCTGATTTGCATAGGGCTCAGG + Intergenic
908912745 1:69091506-69091528 GTCTGATTTGCATAGGGCTCAGG - Intergenic
909671482 1:78193926-78193948 ATCTGATTTAGATGAGACGCTGG - Intergenic
909800277 1:79797547-79797569 CTCTGGTTTGCATAGGGCCCAGG + Intergenic
911285312 1:95984336-95984358 CTCTGTTTTACATGAGGCTCTGG + Intergenic
912047683 1:105480688-105480710 GTCTGATTTGCATAGGGCTCAGG - Intergenic
912510438 1:110185986-110186008 ATCTGATGTTGATAGGGCCCAGG - Intronic
912609412 1:111028177-111028199 GTCTGATTTGCATAGGGCCCAGG - Intergenic
912610003 1:111033213-111033235 GTCTGATTTGCATAGTGCCCAGG - Intergenic
913430438 1:118785325-118785347 GTCTGATTTACATAAGCCTGTGG - Intergenic
916589008 1:166172226-166172248 ATCTGCTTGACCTGAGGCCCAGG - Intergenic
918405515 1:184208238-184208260 ATCAGATGTACCTAATGCCCAGG - Intergenic
919540741 1:198842377-198842399 ATGAGATATACATAAGGCCTGGG - Intergenic
920049835 1:203157146-203157168 ATCTGATTTAGATGAGACTCTGG - Intronic
920639743 1:207740917-207740939 GTCTGATTTGCATAGGGCTCAGG - Intergenic
920910656 1:210213400-210213422 ATCTGATTTATATAGGGCCCAGG - Intergenic
922550631 1:226491601-226491623 GTCTGATTTGCATAGGGCCCAGG + Intergenic
922849866 1:228723366-228723388 GTCTGATTTGCATAGGGCTCAGG + Intergenic
923003313 1:230025256-230025278 ATCTGAATTACAAAAGGACATGG - Intergenic
1065462594 10:25984461-25984483 TTCTGGTTTGCATAGGGCCCAGG - Intronic
1066110045 10:32187749-32187771 GTCTGATTTACATAGGGCTCAGG + Intergenic
1066115091 10:32232757-32232779 GACTGATTTACATAGGGCCCAGG - Intergenic
1067109476 10:43390051-43390073 AGGGGATTTAGATAAGGCCCTGG - Intronic
1067304147 10:45044303-45044325 GACTGATTGACATAGGGCCCAGG + Intergenic
1068161540 10:53271561-53271583 GTCTGATTTTCATAGGGCTCAGG - Intergenic
1068522473 10:58093144-58093166 ATCTGATTTACATAGGGCCCAGG + Intergenic
1071164299 10:82786586-82786608 ATCTGATTTAGATGAGGCTCTGG + Intronic
1071902455 10:90135834-90135856 GTTTGATTTGCATAGGGCCCAGG - Intergenic
1071902878 10:90139777-90139799 GTTTGATTTGCATAGGGCCCAGG - Intergenic
1072677644 10:97480188-97480210 GTCTGATTTGCATAGGGCTCGGG - Intronic
1073732777 10:106310347-106310369 ATCAACTTTACCTAAGGCCCTGG + Intergenic
1073838501 10:107471434-107471456 GTCTGATTTCCATAGGGCTCAGG + Intergenic
1075094677 10:119463160-119463182 ATCAGACTTCCATAAGGCCGAGG - Intergenic
1075366083 10:121891208-121891230 AACTGATTTACATGGGGCTCAGG + Intronic
1080129013 11:28771033-28771055 ATCTGATTTACATGAGACTGTGG + Intergenic
1080725663 11:34897868-34897890 GTCTGATTTTCATAGGGCCCAGG - Intronic
1081189030 11:40080775-40080797 GTCTGATTTGCATATGGCTCGGG - Intergenic
1086058481 11:82675935-82675957 GTCTGATTTGCATGGGGCCCAGG + Intergenic
1086059230 11:82683127-82683149 GTCTGATTTGCATAGGGCCCAGG + Intergenic
1087205692 11:95391628-95391650 ATCTGATTTAGATGAGACTCTGG - Intergenic
1087462570 11:98463526-98463548 ATCTGATTTAGATGAGACTCTGG + Intergenic
1087518130 11:99193431-99193453 ATCTGCTGCACATAAGGCCAGGG - Intronic
1088349313 11:108866769-108866791 ATTTAATTTACTTAAGCCCCAGG - Intronic
1088378208 11:109164692-109164714 ACCTGATTTATCTTAGGCCCTGG + Intergenic
1090324542 11:125873764-125873786 ATCTGATTTACATAGGGCCTAGG - Intergenic
1090862556 11:130666823-130666845 ATCTGATTTAATTAAGACTCTGG + Intergenic
1091035645 11:132230714-132230736 ATTTGTTTTATATCAGGCCCCGG - Intronic
1092336430 12:7638316-7638338 GTCTAATTTGCATAGGGCCCAGG - Intergenic
1093066746 12:14666092-14666114 GTCTGATTTATATAGGGCCCAGG + Intronic
1093763782 12:22939344-22939366 ATCTGATTTAGATGAGACTCTGG + Intergenic
1093818830 12:23585965-23585987 ATTTGATTCACATAGGGCCCAGG - Intronic
1094386036 12:29895253-29895275 ATCTGATCTAGATGAGGCTCTGG - Intergenic
1094783897 12:33823324-33823346 ATCTGGATTTCATAAGGGCCGGG + Intergenic
1095381215 12:41595663-41595685 ATCTGATTTAGATGAGACTCTGG - Intergenic
1095731142 12:45508249-45508271 ATCTGATTTAGATGAGACTCTGG - Intergenic
1097029537 12:56081069-56081091 ATCTACTATACACAAGGCCCTGG + Intronic
1098307422 12:69115955-69115977 GTCTGATTTGCATAGGGCTCAGG + Intergenic
1098972681 12:76872665-76872687 GTCTGATTTACATAGGGCTTAGG - Intronic
1101808843 12:108090606-108090628 GTCTGATTTGCATAGGGCTCAGG + Intergenic
1105708426 13:22982886-22982908 ATCTGCTCTACACAAAGCCCAGG - Intergenic
1108397021 13:49999292-49999314 TGGTGATTTACATAGGGCCCAGG - Intronic
1108873768 13:55019203-55019225 ATCTGATTTAGATGAGACTCTGG + Intergenic
1109682297 13:65768684-65768706 GTCTGATTTGCATAGGGCTCAGG + Intergenic
1110048906 13:70869528-70869550 TTCTAGTTTAAATAAGGCCCTGG - Intergenic
1110636112 13:77768490-77768512 ATCTGATTTACATAAGGCCCAGG - Intergenic
1110911892 13:80976109-80976131 ATCTGATTTACATGAAACTCTGG - Intergenic
1111301283 13:86354127-86354149 GTCTGATTTGCATAGGGCTCAGG + Intergenic
1112124316 13:96447732-96447754 GTCTGATTTGCATAGGGCTCAGG - Intronic
1112170360 13:96966711-96966733 GTCTGATTTGCATAGGGCCCAGG - Intergenic
1113129860 13:107023659-107023681 GTCTGATTTGCATAGGGCTCAGG - Intergenic
1113351073 13:109529811-109529833 GTCTGATATTCATAAAGCCCAGG + Intergenic
1114131472 14:19798297-19798319 GTCTGATTTGCATAGGGCCCAGG + Intronic
1114293560 14:21308810-21308832 GTCTGATTTGCATAGGGCTCAGG + Intronic
1114757746 14:25279423-25279445 ATCTGATCTCCCTAATGCCCAGG - Intergenic
1116301131 14:43184770-43184792 GTCTGATTTGCATAGGGCTCAGG - Intergenic
1117754927 14:58964880-58964902 GATTGATTTACATAGGGCCCAGG - Intergenic
1117883540 14:60335513-60335535 CACTGATTTACATAAGGGCTGGG - Intergenic
1118654099 14:67928458-67928480 GTCTGATTTGCATACAGCCCAGG + Intronic
1120265969 14:82251581-82251603 GTCTGATTTGCATAGGGCTCAGG + Intergenic
1120395496 14:83962404-83962426 GTCTGATTTGCATAGGGCTCAGG + Intergenic
1121199947 14:92108476-92108498 GTCTGATTTGCATAGGGCTCAGG + Intergenic
1122727761 14:103770218-103770240 GACTTATTCACATAAGGCCCAGG + Intronic
1123574533 15:21654000-21654022 GTCTGATTTGCATAGGGCCCAGG + Intergenic
1123611147 15:22096496-22096518 GTCTGATTTGCATAGGGCCCAGG + Intergenic
1123726658 15:23109893-23109915 ATCTGATTTTTATAAGGAGCTGG + Intergenic
1125475008 15:40041233-40041255 GTGTGTTTTACATATGGCCCAGG + Intergenic
1126717441 15:51534268-51534290 ATCTGTTTTACATTTGACCCTGG - Intronic
1128059249 15:64723915-64723937 ATCTTATTCACATAAGTACCTGG + Intergenic
1128359222 15:66949044-66949066 ATCTGATTTAGATGAGACTCTGG + Intergenic
1130277090 15:82486006-82486028 GTCTGATTTGCACAGGGCCCAGG + Intergenic
1130469452 15:84213356-84213378 GTCTGATTTGCACAGGGCCCAGG + Intergenic
1130476942 15:84327920-84327942 GTCTGATTTGCACAGGGCCCAGG + Intergenic
1130494823 15:84460210-84460232 GTCTGATTTGCACAGGGCCCAGG - Intergenic
1130591746 15:85217985-85218007 GTCTGATTTGCACAGGGCCCAGG + Intergenic
1130706339 15:86236787-86236809 ATCTGATTTGCATAGGGCTCAGG + Intronic
1131006935 15:88986090-88986112 GTCTGGTTTCCATAAGACCCAGG + Intergenic
1202983396 15_KI270727v1_random:388252-388274 GTCTGATTTGCATAGGGCCCAGG + Intergenic
1133330327 16:4969030-4969052 AACTCATTTAAATAAGGCCCCGG - Intronic
1133631346 16:7625064-7625086 GTCTGATTTGCATACAGCCCAGG + Intronic
1133650941 16:7814154-7814176 GTCTGATTTGCATGAGGCTCAGG - Intergenic
1135912199 16:26571668-26571690 ATCTGATTTAGATGAGACTCTGG - Intergenic
1136352368 16:29719295-29719317 GTCTGATTTGCATAGGGCTCAGG - Intergenic
1139167170 16:64580855-64580877 AATTGATTTACATAGGGCCCAGG - Intergenic
1139969493 16:70765054-70765076 ACCTGCTTTGCATAAGGCCTTGG - Intronic
1141360362 16:83390089-83390111 CACTGATTTACACATGGCCCAGG - Intronic
1143326143 17:6099733-6099755 GTCTGCGTTCCATAAGGCCCAGG - Intronic
1143370783 17:6437739-6437761 GTCTGATTTCCATAGGGCCCAGG - Intergenic
1144012354 17:11161747-11161769 GTCTGATTTGCATAGGGCTCAGG - Intergenic
1144127975 17:12220546-12220568 GTCTGATTTGCATAGGGCCCAGG + Intergenic
1144150612 17:12439762-12439784 GTCTGATTTGCATAGGGCTCAGG + Intergenic
1149046709 17:52254954-52254976 GTCTGATTTGCACAGGGCCCAGG + Intergenic
1149207678 17:54267285-54267307 ATTTGATTTGCATAGGGCTCAGG + Intergenic
1150926861 17:69541341-69541363 CTCTGATTTACAAATAGCCCTGG - Intronic
1151506662 17:74532334-74532356 ACCTGATTTGCATAGGGCCCAGG - Intergenic
1153170527 18:2311156-2311178 GTCTAGTTTGCATAAGGCCCAGG - Intergenic
1154005445 18:10523619-10523641 GTCTGGTTTGCATAGGGCCCAGG + Intergenic
1155613468 18:27695302-27695324 GTCTGATTTGCATAGGGCTCAGG - Intergenic
1155771872 18:29711996-29712018 GTCTGATTTGCATAGGGCTCAGG + Intergenic
1155829251 18:30492294-30492316 ATGTTATTTGCATAATGCCCTGG + Intergenic
1155934411 18:31740278-31740300 GTCTGATTTGCATAGGGCCCAGG + Intergenic
1155934979 18:31744412-31744434 GTCTGATTTGCACAGGGCCCAGG + Intergenic
1156784821 18:40897990-40898012 GTCTGATTTACATAGGGCCCAGG + Intergenic
1156811734 18:41261001-41261023 ATATGATTTAAATCAGGTCCAGG + Intergenic
1157891065 18:51418397-51418419 GTTTGATTTACATAGGGCCCAGG - Intergenic
1161242283 19:3229027-3229049 AACAGACTTTCATAAGGCCCCGG + Intronic
1162018339 19:7857431-7857453 ACCATATTCACATAAGGCCCTGG + Intronic
1163070617 19:14837636-14837658 GTCTGATTTACATAGGGCCCAGG - Intergenic
1164061617 19:21680269-21680291 GATTGATTTACATAGGGCCCAGG - Intergenic
1164064645 19:21705503-21705525 GATTGATTTACATAGGGCCCAGG + Intergenic
1165112478 19:33510444-33510466 GTCTGATTTACATAGGGCTCAGG + Intronic
1165271578 19:34712137-34712159 GATTGATTTACATAGGGCCCAGG - Intergenic
1165975318 19:39671325-39671347 TTCTGGTTTCCATAGGGCCCAGG - Intergenic
1166414462 19:42583707-42583729 AGCTGATTGACAGAAGGCCCAGG + Intronic
1166430698 19:42724410-42724432 ACTTGATTGACAGAAGGCCCAGG + Intronic
1166451163 19:42902445-42902467 ACCTGATTGACAGAAGGCCCAGG + Intronic
1166463407 19:43010426-43010448 ACCTGATTGACAGAAGGCCCAGG + Intronic
1166469550 19:43066985-43067007 ACCTGATTGGCAGAAGGCCCAGG + Intronic
1166490271 19:43253645-43253667 ACCTGATTGACAGAAGGCCCAGG + Exonic
1168183167 19:54677451-54677473 GTCTGGTTTGCATAGGGCCCAGG - Intronic
925111491 2:1342046-1342068 GTCTGAATTACCTAAGTCCCAGG - Intronic
926257703 2:11222761-11222783 ATCTGTGTTATACAAGGCCCTGG + Intronic
926564147 2:14451790-14451812 ATCTGATTTAGATGAGACTCTGG - Intergenic
930621331 2:53646880-53646902 GTCTGATTTGCATAGGGCCCAGG + Intronic
931345765 2:61444737-61444759 GTCTGATTTGCATAGGGCTCAGG - Intronic
931687670 2:64808342-64808364 ATGACATTTACATAGGGCCCAGG - Intergenic
932799894 2:74732021-74732043 ATGTGATTTACCTATGGACCCGG + Intergenic
934028966 2:88024593-88024615 GTCTGGTTTCCATAGGGCCCAGG + Intergenic
934233174 2:90205400-90205422 GTCTGATTTGCATAGGGCTCAGG + Intergenic
934569377 2:95359193-95359215 ATCTGATTTAGATGAGACTCTGG - Intronic
935162078 2:100537936-100537958 GTCTGATTTGCATAGGGCTCAGG + Intergenic
936349840 2:111704183-111704205 ATCTGATATACATAAGGAATCGG + Intergenic
937126053 2:119475788-119475810 ATCTGATTTTCAGAAGGCTCCGG + Intronic
937169735 2:119854062-119854084 GTCTGATTTGCATAGGGCTCAGG + Intronic
937838461 2:126498189-126498211 GTCTGATTTACACAGGGCCCAGG + Intergenic
937882096 2:126876004-126876026 GCCTGATTTATATATGGCCCAGG + Intergenic
941443779 2:165574197-165574219 GTCTCATTTGCATAAGGCTCAGG - Intronic
942237713 2:173928303-173928325 CTCTGACTTACATGAGGGCCTGG - Intronic
943361640 2:186925753-186925775 GTCTGATTTGCATAGGGTCCAGG + Intergenic
943446741 2:187995781-187995803 ATCTGATTTGCATAGGGCTCTGG - Intergenic
943451455 2:188046660-188046682 ATCTGATTTAGATAAAACTCTGG + Intergenic
943618359 2:190119357-190119379 GTCTGATTTGCATAGGGCTCAGG + Intronic
1170101162 20:12701022-12701044 GTCTGATTTGCATAGGGCCCAGG - Intergenic
1173467654 20:43296054-43296076 GTCTGATTTGCATAAGGCTCAGG - Intergenic
1173689224 20:44946688-44946710 ATCTGAATGACACAATGCCCAGG - Intronic
1174056949 20:47804532-47804554 GTCTGATTTGCATAGGGCTCAGG - Intergenic
1174660566 20:52209282-52209304 GTCTGATTTGCATAGGGCTCAGG + Intergenic
1179161803 21:38905502-38905524 GTCTGATTTGCATAGGGCTCAGG + Intergenic
1181376206 22:22460157-22460179 GTCTGATTTGCAAAGGGCCCAGG + Intergenic
1181376792 22:22465155-22465177 GTCTGATTTGCACAGGGCCCAGG + Intergenic
1181641908 22:24205873-24205895 GTTTGATCTGCATAAGGCCCAGG + Intergenic
1181682860 22:24507914-24507936 GTCTGATTTGCATAGGGCCCAGG - Intronic
1183196964 22:36360198-36360220 AACTGATTTTCAGAGGGCCCAGG - Intronic
1183282675 22:36940759-36940781 ATCTGATTTGCATAGGGCTCAGG + Intergenic
949149310 3:745592-745614 AGCTGATTTGTATAAAGCCCTGG - Intergenic
949669187 3:6378517-6378539 GTCTAATTTGCACAAGGCCCAGG - Intergenic
949763924 3:7504918-7504940 ATCTGATTTAAATGAGACTCTGG - Intronic
949821683 3:8123049-8123071 ATCTGATTTAAATAAGACTCTGG - Intergenic
954651573 3:52167400-52167422 GTTTGATTTACATAGGACCCCGG - Intergenic
956749337 3:72333784-72333806 ATCTGAGTAACAGAAGGCTCTGG + Intergenic
958262527 3:91398265-91398287 ATCTGCCTTACATCAGGCACAGG + Intergenic
958555625 3:95672843-95672865 ATCTGATTTAGATGAGACTCTGG - Intergenic
958574261 3:95927158-95927180 GTCTGATTTGCATAGGGCTCAGG + Intergenic
959753517 3:109867665-109867687 ATATTTTTTACATAATGCCCCGG - Intergenic
960210829 3:114963862-114963884 ATCTGATTTCCTTGAGGCCAAGG - Intronic
960682549 3:120264077-120264099 GTCTGATTTGCATAGGGCTCAGG - Intronic
961510649 3:127400839-127400861 ATTAGATTTAGATAAGGCCTGGG - Intergenic
962458892 3:135590961-135590983 GTCTGATTTGCATAAAGCTCGGG - Intergenic
962718020 3:138144863-138144885 ATCTGATTTAAAAATGGACCAGG + Intergenic
962737210 3:138336594-138336616 AATTGATTTACATAGGGCCTAGG + Intergenic
963226425 3:142867103-142867125 GTCTGATTTGCATAGGGCCCAGG - Intronic
964195784 3:154062772-154062794 GTCTGATTTGCATAGGGCTCAGG - Intergenic
965000370 3:162945175-162945197 ATCTGATTTAGATAAGATTCTGG + Intergenic
965099413 3:164277527-164277549 ATCTGATTTGCACAGGGCTCAGG + Intergenic
965492607 3:169358014-169358036 GTTGGATTTACATAAGGCGCTGG - Intronic
965819059 3:172666385-172666407 GTCTGGTTTGCATAGGGCCCAGG - Intronic
965820098 3:172676514-172676536 GTCTGGTTTGCATAGGGCCCAGG - Intronic
966338962 3:178903488-178903510 ATCTGAGTTAGATGAGGCTCTGG + Intergenic
966936171 3:184711281-184711303 CTCTCATATAGATAAGGCCCAGG + Exonic
968005910 3:195242656-195242678 GTCTGATCTGCATAGGGCCCAGG + Intronic
968399910 4:285100-285122 ATCTGATTTCCAGCAGGGCCTGG + Intronic
968407616 4:354337-354359 ACCTGATTTCCAGCAGGCCCTGG - Intronic
972216328 4:36900789-36900811 GTCTGATTTGCATAGGGCTCAGG - Intergenic
973908781 4:55557725-55557747 ATCTGATTTAGATGAGACTCTGG - Intronic
974332210 4:60495602-60495624 GTCTGATTTGCATAGGGCCCAGG + Intergenic
974358250 4:60840410-60840432 AGTTGATTTACTTAAGTCCCTGG - Intergenic
974424494 4:61723522-61723544 GTCTGATTTGCATAGGGCCCAGG + Intronic
974648068 4:64719131-64719153 GTCTGATTTGCATAAGGCCCAGG + Intergenic
974914005 4:68157193-68157215 GTCTGATTTGCATAGGACCCAGG + Intergenic
975730151 4:77329923-77329945 ATCTGATTTGCATAGGGCTCAGG + Intronic
976267221 4:83195620-83195642 GTCTGATTTGCATAGGGCTCAGG - Intergenic
976396929 4:84566028-84566050 GATTGATTTACATAAGGCCCAGG + Intergenic
977954445 4:103011014-103011036 ATCTGATTTAGATGAGACTCTGG - Intronic
978476224 4:109134391-109134413 ATCTGATTTACACAATGCTTAGG + Intronic
978522960 4:109635564-109635586 GTCTGATTTGCATAGGGCACAGG - Intronic
979840118 4:125428424-125428446 ATGTGACTCACACAAGGCCCAGG + Intronic
979882982 4:125986175-125986197 GTCTGATTTGCATAGGGCTCAGG - Intergenic
980480091 4:133376930-133376952 GTCTGATTTGCATAGGGCTCAGG + Intergenic
980600843 4:135022252-135022274 GTTTGATTTGCATAGGGCCCAGG - Intergenic
981403361 4:144339726-144339748 GTCTGATTTGCATAGGGCTCAGG + Intergenic
981796955 4:148606180-148606202 ATCTGATTTAGATGAGACTCTGG + Intergenic
981893955 4:149774582-149774604 GTCTGATTTGCATAGGGCTCAGG - Intergenic
981980365 4:150784577-150784599 GTCTGATTTGCATAGGGCTCAGG - Intronic
982128814 4:152208357-152208379 ATCTAATTTACAAAAGGCAATGG + Intergenic
983043151 4:162954409-162954431 GTCTGGTTTGCATAGGGCCCAGG + Intergenic
983412279 4:167416782-167416804 GTCTGATTTACACAGGGCCCAGG - Intergenic
983413209 4:167424153-167424175 GTCTGATTTACCTAGGGCCCAGG - Intergenic
983768143 4:171512631-171512653 GTCTGATTTGCATAGGGCTCAGG - Intergenic
984083345 4:175277845-175277867 GACTGATTTACATAGGGCCCAGG + Intergenic
984862258 4:184251732-184251754 GTCTGATTTGCATAGGGCTCAGG + Intergenic
985044300 4:185924697-185924719 GTCTGATTTGCATAGGGCACAGG - Intronic
985400153 4:189586181-189586203 GTCTGATTTCCATAGGGCTCAGG - Intergenic
988523333 5:31965305-31965327 GTCTGATTTGCATAGGGCACAGG + Intronic
988629434 5:32913170-32913192 GTCTGATTTACATAGGGCCCGGG - Intergenic
989315401 5:40072111-40072133 ATCTGATTTACATGAGACTTTGG + Intergenic
989510670 5:42283757-42283779 ATCTCATTTACCTAGGCCCCAGG + Intergenic
993068180 5:83127069-83127091 ATCTGATTTAGATGAGACTCTGG + Intronic
993224881 5:85155955-85155977 ATCTGCTTAACATAAGGCTGTGG - Intergenic
994089980 5:95801162-95801184 GTCTGGTTTGCATAGGGCCCAGG - Intronic
995714901 5:115072750-115072772 GTCTGATTTACATAGGGCCCAGG + Intergenic
996512976 5:124338146-124338168 ATCTGATTTAGATAAGACTCTGG - Intergenic
996977944 5:129457764-129457786 ATCTGGTTTACAGAAGGAACAGG - Intergenic
998345115 5:141455491-141455513 GTCTGATTTGCATAGGGCTCAGG + Intronic
998976151 5:147650546-147650568 ATCTGAATTAAATGAGACCCAGG + Exonic
999499357 5:152131498-152131520 ATCTGATTTAGATGAGACTCCGG - Intergenic
1000187214 5:158870765-158870787 ATCTGGTTCACCTAATGCCCTGG + Intronic
1001307109 5:170583364-170583386 ATCTAATATACACAAGGCACTGG - Intronic
1004640196 6:17507650-17507672 ATCTCCTTGACATAAGGACCAGG - Exonic
1006676059 6:35764551-35764573 GTCTGATTTGCATAGGGCCCAGG + Intergenic
1007940932 6:45780831-45780853 ATCTGCTTGACATAGGGCTCTGG - Intergenic
1008083733 6:47221848-47221870 GTCTGATTTGCATAGGGCTCAGG - Intergenic
1008845425 6:55957469-55957491 GTCTGATTTGCATAGGGCCCAGG + Intergenic
1008974453 6:57408382-57408404 GTCTGATTTGCATATGGCTCAGG + Intronic
1008992892 6:57624612-57624634 ATCTGCCTTACATTAGGCACAGG - Intronic
1009163343 6:60309901-60309923 GTCTGATTTGCATATGGCTCAGG + Intergenic
1009181508 6:60523717-60523739 ATCTGCCTTACATCAGGCACAGG - Intergenic
1009529026 6:64786375-64786397 GTCTGATTTGCATAGGGCTCAGG + Intronic
1009683747 6:66929506-66929528 GTCTGATTTGCATAAGGCCCAGG - Intergenic
1010648578 6:78424234-78424256 GTCTGATTTGCATAGGGCTCAGG + Intergenic
1013426951 6:110020968-110020990 ATCTGATTTAAACAAGTCCTGGG - Intergenic
1013459254 6:110358995-110359017 ATTTGATTTACATCATGCCATGG - Intergenic
1014350360 6:120335344-120335366 ATGAGAATTACATAAGGCTCAGG + Intergenic
1015372342 6:132468229-132468251 ATCTGTTTTAGATAATGCCAAGG + Intronic
1015889478 6:137955311-137955333 GTCTGATTTGCATAGGGCTCAGG + Intergenic
1016733185 6:147448492-147448514 GTCTGATTTGCATAGGGCTCAGG - Intergenic
1016812032 6:148270524-148270546 ATCTAATTTACATAAGGTAGTGG + Intergenic
1017428211 6:154344050-154344072 GTCTGATTTGCATAGGGCTCAGG - Intronic
1018190885 6:161308227-161308249 GTCTGATTTGCATAGGGCTCAGG + Intergenic
1018366284 6:163123154-163123176 GTCTGATTTGCTTAGGGCCCAGG + Intronic
1018593593 6:165454268-165454290 ACCTGATTTAGATGAGACCCTGG + Intronic
1018926264 6:168209126-168209148 GTCTGGTTTGCATAAGGCCGAGG - Intergenic
1019769361 7:2873884-2873906 CTCTGATTTGCATATGGCCCAGG + Intergenic
1020773407 7:12424177-12424199 GTCTGATTTGCATAGGGCCCAGG + Intergenic
1021176997 7:17460724-17460746 GTCTGATTTGCATAGGGCCCAGG + Intergenic
1022279324 7:28890233-28890255 GTCTGATTTGCATAGGGTCCAGG + Intergenic
1022475080 7:30704790-30704812 ATCAGATTTACAGAAGGTCTAGG - Intronic
1023513813 7:40980475-40980497 ATCTGATTTACATAATACTGAGG - Intergenic
1024224969 7:47319592-47319614 GTCTAAATCACATAAGGCCCAGG + Intronic
1024770173 7:52713169-52713191 GTCTGATTTACATAAGGCCCAGG - Intergenic
1024974136 7:55097644-55097666 ACCTGATTTCTATAAGACCCAGG + Intronic
1025009352 7:55383366-55383388 ATCTGATTTACATAGGGCCCAGG + Intronic
1025236063 7:57235646-57235668 GTCTGATTTGCATAGGGCTCAGG + Intergenic
1026369323 7:69683123-69683145 ATCTGATTTGTATAGGGCCCAGG + Intronic
1027502390 7:78969270-78969292 GATTGATTTACATAAGGCCCAGG - Intronic
1028589251 7:92478998-92479020 GTCTGATTTGCACAGGGCCCAGG - Intergenic
1029320166 7:99751889-99751911 ATATCATTTACATAACGCACCGG - Intergenic
1030407128 7:109128958-109128980 GTCTGGTTTCCATAGGGCCCAGG + Intergenic
1033817002 7:145085314-145085336 GTCTGATTTGCATAGGGCTCAGG + Intergenic
1034875354 7:154720411-154720433 CTGAGATGTACATAAGGCCCAGG - Intronic
1035083972 7:156240377-156240399 ATCTGAATTAAATAGGACCCTGG - Intergenic
1039649921 8:39330232-39330254 ATCTAATTTACGTAGGGCCCAGG + Intergenic
1039713861 8:40087703-40087725 GTCTGATTTGCATAGGGCTCAGG - Intergenic
1040401718 8:47057150-47057172 GTCTGATTTGCATAGGGTCCAGG + Intergenic
1040673308 8:49718011-49718033 GTCTGATTTGCATAGGGCTCAGG - Intergenic
1041741817 8:61164641-61164663 GTCTGATTTGCATAGGGCTCAGG - Intronic
1041831833 8:62163276-62163298 GTCTGATTTGCATAGGGCTCAGG + Intergenic
1042071911 8:64944873-64944895 AGCAGATTTACATAATTCCCAGG - Intergenic
1042442879 8:68848433-68848455 GTCTGATTTGCATAGGGCTCAGG - Intergenic
1042710921 8:71716316-71716338 ATTTGATTTACATAGGGCATAGG + Intergenic
1044136461 8:88592127-88592149 GACTGATTTACATAGGGCTCAGG + Intergenic
1044311897 8:90703210-90703232 ATCTGAATTACATGACTCCCAGG - Intronic
1045830901 8:106458977-106458999 ATCTGATTTAGATGAGACTCTGG + Intronic
1046512891 8:115221529-115221551 GTCTGATTTGCATAGGGCTCAGG - Intergenic
1047284952 8:123479882-123479904 GTCTGATTTGCATAGGGCTCAGG - Intergenic
1050829908 9:9997977-9997999 GTCTGATTTGCATATGGCCCAGG - Intronic
1051219921 9:14837240-14837262 GTCTGATTTGCATAGGGCTCAGG - Intronic
1051278323 9:15417956-15417978 ATCTGATTTGCATAGGGCTCAGG - Intergenic
1052528837 9:29656137-29656159 TTCTGATTAACAGAAGGCACAGG + Intergenic
1052718347 9:32145602-32145624 GTCTGGTTTCCATAGGGCCCAGG - Intergenic
1053604107 9:39639751-39639773 ACCTGATTTACATAAACCTCTGG - Intergenic
1053861922 9:42395803-42395825 ACCTGATTTACATAAACCTCTGG - Intergenic
1054249433 9:62702663-62702685 ACCTGATTTACATAAACCTCTGG + Intergenic
1054563544 9:66737195-66737217 ACCTGATTTACATAAACCTCTGG + Intergenic
1055840150 9:80493880-80493902 ATCTGATTTAGATTAGGCTCTGG - Intergenic
1056386635 9:86102216-86102238 ATCTGATTTAGATGAGACTCTGG - Intergenic
1057629133 9:96705818-96705840 ATCTGTTCTCCACAAGGCCCAGG + Intergenic
1059007124 9:110415365-110415387 ATGTGGCTTATATAAGGCCCAGG + Intronic
1185862491 X:3592263-3592285 ATCTGATTTGCATAGGGCTTAGG + Intergenic
1186055138 X:5642194-5642216 ATCTGATTTGCATAGGGCTCAGG - Intergenic
1186861053 X:13672991-13673013 ATCTGATTTGCATATTCCCCAGG - Intronic
1188148943 X:26648994-26649016 GTGTGATTTGCATAGGGCCCAGG + Intergenic
1188149539 X:26654434-26654456 GTTTGATTTGCATAGGGCCCAGG + Intergenic
1188518723 X:31014557-31014579 GTCTGATTTGCATAGGGCTCAGG + Intergenic
1189027226 X:37408357-37408379 GTCTGATTTGCATAGGGCTCAGG + Intronic
1189590392 X:42505130-42505152 GTCTGATTTGCATAGGGCTCTGG + Intergenic
1189783830 X:44542303-44542325 ATCTGCTTTCCCAAAGGCCCGGG + Intronic
1190112884 X:47606264-47606286 ATGTAAGTTTCATAAGGCCCAGG + Intronic
1190538797 X:51456519-51456541 GTTTGATTTGCATAGGGCCCAGG - Intergenic
1190539433 X:51461926-51461948 GTCTGATTTGCATAAGGCCCAGG - Intergenic
1191204169 X:57816772-57816794 TTCTAATTTGCATAGGGCCCAGG + Intergenic
1191204859 X:57822865-57822887 GTCTGATTTGCATAGGGTCCAGG + Intergenic
1191889553 X:65926255-65926277 GTCTGGTTTGCATAAGGCTCAGG + Intergenic
1191936212 X:66429718-66429740 GTCTGATTTGCATAGGGCTCAGG + Intergenic
1192190227 X:68986742-68986764 ATCTGATCTACTCAAGGCCCCGG - Intergenic
1192658159 X:73014023-73014045 ATCTGATTTAAATGAGACTCTGG - Intergenic
1192765776 X:74138257-74138279 ATCTGATTTGCATAGGGCTCAGG - Intergenic
1192863047 X:75098856-75098878 AAGTGATTTACACCAGGCCCAGG + Intronic
1194001034 X:88428627-88428649 ATCTGATTTGGATAAGACCCTGG + Intergenic
1194104930 X:89757220-89757242 GTTTGATTTGCATAGGGCCCAGG + Intergenic
1194105554 X:89762722-89762744 TGTTGATTTACATAGGGCCCAGG + Intergenic
1194207382 X:91028442-91028464 GTCTGATTTGCATAGGGCTCAGG + Intergenic
1194222561 X:91213705-91213727 GTCTGGTTTACATAGGGCCCAGG + Intergenic
1194476627 X:94366926-94366948 GTCTGATTTGCATAGGGCTCAGG - Intergenic
1194533038 X:95074357-95074379 ACCTGATTTGCATAGGGCCCAGG + Intergenic
1194533646 X:95079585-95079607 GCCTGATTTGCATAGGGCCCAGG + Intergenic
1195138550 X:101934590-101934612 ATCTAACTTACATAAGGACAAGG - Intergenic
1195336201 X:103857344-103857366 GTCTGATTTACATAGGGCCCAGG + Intergenic
1195920408 X:109977896-109977918 GTCTGATTTGCATAGGGCTCAGG - Intergenic
1197209847 X:123819574-123819596 GTCTGATTTGCATAGGGCTCAGG + Intergenic
1197662394 X:129188271-129188293 ATCTGATTTGCACAGGGCTCAGG + Intergenic
1197984776 X:132255938-132255960 ATCTGAGTCCCATAAGGCCAAGG + Intergenic
1198741993 X:139851975-139851997 ATCTGATTTAGATGAGACTCTGG + Intronic
1198847769 X:140931221-140931243 GTCTGATTTGCATAGGGCTCAGG - Intergenic
1199018630 X:142848690-142848712 GTCTGATTTGCATAGGGCGCAGG - Intergenic
1200456894 Y:3405009-3405031 GTTTGATTTGCATAGGGCCCAGG + Intergenic
1200457518 Y:3410547-3410569 TGTTGATTTACATAGGGCCCAGG + Intergenic
1200553182 Y:4603492-4603514 GTCTGATTTGCATAGGGCTCAGG + Intergenic
1200559090 Y:4677470-4677492 GTCGGGTTTACATAGGGCCCAGG + Intergenic
1202060687 Y:20884744-20884766 GTCTGATTTCCATAGGGCTCCGG - Intergenic
1202061732 Y:20896251-20896273 GTCTGATTTGCATATGGCTCAGG - Intergenic