ID: 1110636114

View in Genome Browser
Species Human (GRCh38)
Location 13:77768514-77768536
Sequence TATAGAGGGGCTCGAGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 6, 2: 8, 3: 138, 4: 402}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110636114_1110636121 5 Left 1110636114 13:77768514-77768536 CCGCCTCCTCGAGCCCCTCTATA 0: 1
1: 6
2: 8
3: 138
4: 402
Right 1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 31
1110636114_1110636122 6 Left 1110636114 13:77768514-77768536 CCGCCTCCTCGAGCCCCTCTATA 0: 1
1: 6
2: 8
3: 138
4: 402
Right 1110636122 13:77768543-77768565 ACCGCATCCCGCTGCTAACAGGG 0: 1
1: 0
2: 0
3: 7
4: 28
1110636114_1110636126 18 Left 1110636114 13:77768514-77768536 CCGCCTCCTCGAGCCCCTCTATA 0: 1
1: 6
2: 8
3: 138
4: 402
Right 1110636126 13:77768555-77768577 TGCTAACAGGGAGATCCATTCGG 0: 1
1: 0
2: 3
3: 10
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110636114 Original CRISPR TATAGAGGGGCTCGAGGAGG CGG (reversed) Intergenic
901937202 1:12635133-12635155 TGTAGATGAGCTTGAGGAGGCGG - Intergenic
902146377 1:14403990-14404012 TATAGAGGAACTTGAGGGGGTGG + Intergenic
902668233 1:17954122-17954144 TAAAGACGGGCTGGAGGAGGAGG + Intergenic
903959802 1:27049724-27049746 TATACAGAGGCTGGAGGAGGCGG + Intergenic
904052048 1:27645669-27645691 TATAGAGGGGCTGGAGGTGATGG + Intergenic
904339078 1:29821693-29821715 TATAGATGAGCTTGAGGAGGTGG + Intergenic
905696710 1:39979956-39979978 TATGAAGAGGCTGGAGGAGGCGG - Intergenic
906558878 1:46739039-46739061 AATAGAGAGGCTCAAGGAGAGGG + Intergenic
907568239 1:55457489-55457511 TATTGGGAGGCTGGAGGAGGCGG + Intergenic
907795248 1:57709672-57709694 TATAGATGAGCTTGAGGAGGTGG + Intronic
908389604 1:63672674-63672696 TATAGACCGGCTTGAGGAGGTGG + Intergenic
909800273 1:79797523-79797545 TATTGGGAGGCTGGAGGAGGTGG + Intergenic
911011955 1:93289662-93289684 TATAGATGAGCTTGAGGAGGTGG + Intergenic
911164360 1:94711964-94711986 TATAGAAGGGCTTGAGGGAGTGG - Intergenic
911330277 1:96518804-96518826 TATAGGCAGGCTTGAGGAGGTGG + Intergenic
912902509 1:113667853-113667875 AATAGAGGGGCCTGAGGAGAGGG + Intronic
912938378 1:114023569-114023591 TATAGACAGGCTTGAGGAGACGG - Intergenic
915116785 1:153606414-153606436 TATACAGAGGCTGGAGGAGGAGG - Intergenic
916042811 1:160975895-160975917 TACAGACGAGCTTGAGGAGGAGG + Intergenic
916266158 1:162891691-162891713 TATAGAGGAGCTTGAGGAGGTGG + Intergenic
916302359 1:163290158-163290180 TATAGAGGAGCCTGAGGAGGTGG - Intronic
917631611 1:176896499-176896521 TGGTGAGGGGCTGGAGGAGGGGG - Intronic
918104078 1:181401335-181401357 TATAGAGGGTCTTGGGGAGTTGG - Intergenic
918460491 1:184771519-184771541 TATAGGCAGGCTTGAGGAGGCGG - Intergenic
919047815 1:192475675-192475697 TATAGGCAGGCTTGAGGAGGAGG - Intergenic
920639746 1:207740941-207740963 TATGTAGAGGCTGGAGGAGGTGG - Intergenic
920640602 1:207748312-207748334 TATACATAGGCTGGAGGAGGCGG - Intergenic
921413767 1:214866980-214867002 TATAGGCAGGCTTGAGGAGGCGG - Intergenic
921789187 1:219270375-219270397 TATGGATGAGCTTGAGGAGGTGG + Intergenic
921836341 1:219782579-219782601 TATAGACAAGCTCGAGGAGGTGG - Intronic
921841598 1:219834649-219834671 TATAGATGAGCTTGAGGAGGTGG - Intronic
921984216 1:221292965-221292987 TCTAGATGAGCTTGAGGAGGCGG - Intergenic
921987931 1:221332898-221332920 TATAGGCAGGCTGGAGGAGGCGG + Intergenic
922155166 1:223035326-223035348 TATAGATGAGCTTGAGGAGGTGG + Intergenic
922550628 1:226491577-226491599 TATATAGAGGCTGGAGGAGGTGG + Intergenic
922887434 1:229031000-229031022 TATAGAGGGGCTTGAGGAGGCGG - Intergenic
923051726 1:230394892-230394914 GAGAGAGGAGCTCGAGGATGGGG - Intronic
923647739 1:235841279-235841301 TAGAGAGGAGCTGGAGAAGGAGG + Intronic
923699723 1:236288323-236288345 TATAGTTCGGCTTGAGGAGGCGG - Intergenic
923804106 1:237239395-237239417 TATAGAGTAGCTTGAGGAGGCGG + Intronic
924089359 1:240486613-240486635 TATAGATGAGTTTGAGGAGGCGG - Intergenic
924168619 1:241312665-241312687 AATAGAGGGGCCCGAGGAGTGGG - Intronic
924623563 1:245682911-245682933 TATAGAGGAGGAGGAGGAGGAGG - Intronic
924712122 1:246538123-246538145 TATAGATGTGCTTGAGGAGGTGG - Intergenic
1063020244 10:2119743-2119765 TATAGACTGGCTTGAGGAGGTGG + Intergenic
1063369298 10:5510776-5510798 AAAAGTGGGGCTCGAGGAAGGGG - Intergenic
1063689796 10:8275975-8275997 TATAGGCAGGCTTGAGGAGGTGG + Intergenic
1063740126 10:8808109-8808131 TATAGGCAGGCTTGAGGAGGCGG + Intergenic
1063827275 10:9911750-9911772 TATAGAAGAGCTTGAGGAGGCGG - Intergenic
1063902103 10:10744818-10744840 TAAAGAGGCTCTCTAGGAGGAGG + Intergenic
1064137810 10:12765805-12765827 TATAGCTGAGCTTGAGGAGGTGG + Intronic
1064215928 10:13400640-13400662 TATAGACTGGCTTGAAGAGGCGG + Intergenic
1064677976 10:17780878-17780900 TATAGACAGGCTTTAGGAGGTGG + Intronic
1064736102 10:18383351-18383373 TATAGAGGGGCTAGCAGAAGTGG + Intronic
1064803113 10:19098867-19098889 TATAGATGAGCTTGAGGAAGCGG + Intronic
1064930065 10:20615191-20615213 CATAGAGGAGCTTGAGGAGGCGG - Intergenic
1064953213 10:20877806-20877828 TATAGACAGGCTTGAGGAGTCGG - Intronic
1065006794 10:21387716-21387738 TATAGAGGAGCTTGAGGAGGAGG - Intergenic
1065442203 10:25764187-25764209 TATAGACAAGCTTGAGGAGGCGG - Intergenic
1065462598 10:25984485-25984507 TATCGGGAGGCTGGAGGAGGTGG - Intronic
1065502410 10:26395119-26395141 TGTAGACAGGCTTGAGGAGGTGG - Intergenic
1066110042 10:32187725-32187747 TATACAGAGGCTGGAGGAGGTGG + Intergenic
1066471295 10:35700806-35700828 TATAAGGAGGCTAGAGGAGGCGG - Intergenic
1066660442 10:37734400-37734422 TATAGAAGAACTCGAGGAGGTGG + Intergenic
1067742353 10:48905240-48905262 TATAGAGGGGCAGGTAGAGGAGG + Intronic
1068285613 10:54930297-54930319 TATAGACTGGCTTGAGGAGGTGG - Intronic
1068507076 10:57914735-57914757 TATAGACGAGCTTGAGGAGGCGG + Intergenic
1068601421 10:58960951-58960973 TATAGGCAGGCTTGAGGAGGTGG - Intergenic
1069236900 10:66087197-66087219 TATAGAGGGGCTTGAGGAGATGG - Intronic
1069755047 10:70769357-70769379 TATAGATGAGGTTGAGGAGGCGG - Intergenic
1070417927 10:76207643-76207665 TATGGAGGGGACAGAGGAGGTGG - Intronic
1071199883 10:83209425-83209447 TAATGAGGGGGTGGAGGAGGGGG - Intergenic
1071219273 10:83444836-83444858 TATAGGCAGGCTTGAGGAGGTGG + Intergenic
1071850009 10:89558942-89558964 TATTGGGAGGCTGGAGGAGGTGG + Intergenic
1072167613 10:92829292-92829314 TATAGACAGGCTTGAGGAGGTGG - Intergenic
1072252167 10:93590285-93590307 TATAGGCAGGCTTGAGGAGGTGG + Intronic
1073453313 10:103622189-103622211 GGTACAGGGGCTTGAGGAGGGGG - Intronic
1073893950 10:108132445-108132467 TATAGACAGGCTTGAGGAGGTGG + Intergenic
1073956197 10:108874289-108874311 CATAGAGGTGCTGGAGGGGGAGG - Intergenic
1074623255 10:115149047-115149069 TATAGAGGGGCTTTTGGAGGCGG + Intronic
1074634971 10:115304601-115304623 TATGTAGAGGCTGGAGGAGGGGG + Intronic
1074691694 10:116011473-116011495 TATAGACTGGCTTGAGGAGGTGG + Intergenic
1075823153 10:125331270-125331292 TATGGAGGGGCAGGAGGGGGTGG - Intergenic
1075978320 10:126716094-126716116 TATAGATTAGCTTGAGGAGGTGG - Intergenic
1077482150 11:2820804-2820826 TCCAGAGGGGCTCTAGCAGGAGG - Intronic
1077799352 11:5522692-5522714 TATAGAGAGGCTTGTGTAGGGGG - Intronic
1079129343 11:17738324-17738346 TGGGGAGGGGCTGGAGGAGGGGG + Intronic
1079208114 11:18435408-18435430 TACAGCGGGGGTCGGGGAGGGGG - Intronic
1079359444 11:19758413-19758435 TAGAGAGGGGCTGAAGGAGCTGG + Intronic
1081363058 11:42203586-42203608 TATAGACGAGCTTGATGAGGTGG - Intergenic
1081530366 11:43954412-43954434 TATAGATGAGCTTGAGGAGGCGG + Intergenic
1082120956 11:48379194-48379216 TATAGATGAGCTTGAGGAGGTGG + Intergenic
1082252888 11:50001455-50001477 TATAGATGAGCTTGAGGAGGTGG - Intergenic
1084914860 11:72421173-72421195 TATACAGAGGCTGGAGGAGGTGG - Intronic
1085254952 11:75167119-75167141 GCTGGAGGGGCTAGAGGAGGTGG + Intronic
1085396361 11:76208970-76208992 TAAGCCGGGGCTCGAGGAGGGGG + Intronic
1087274155 11:96143778-96143800 TTCAGAGGGGCTCCTGGAGGTGG - Intronic
1088749987 11:112835253-112835275 TATAGCTGGGCTCATGGAGGAGG - Intergenic
1089121455 11:116138586-116138608 AATGGAGGGGTTGGAGGAGGAGG - Intergenic
1089174161 11:116536391-116536413 TGCAGAGGGGCTGGAGGAGGAGG - Intergenic
1090062043 11:123472648-123472670 TATAGACAGGCTTGAGGAGGTGG + Intergenic
1090401647 11:126453086-126453108 TTCAGAGGGGCTGGGGGAGGTGG - Intronic
1090878337 11:130811417-130811439 TATAGAGGGGCTTGAGGAGGCGG + Intergenic
1091504785 12:1056485-1056507 TATAGATAAGCTTGAGGAGGTGG + Intronic
1092169367 12:6363676-6363698 TAAAGAGGAGCTGGAGGAGCTGG - Exonic
1092793365 12:12088262-12088284 TATAGACAGGTTTGAGGAGGTGG + Intronic
1093066743 12:14666068-14666090 TATAGGGAGGCTTCAGGAGGCGG + Intronic
1093071878 12:14714504-14714526 TGTACAGAGGCTTGAGGAGGCGG + Intergenic
1093519121 12:20027444-20027466 TATAGATGAGCTTGAGGAGGTGG - Intergenic
1093928703 12:24933831-24933853 TATAGTCAGGCTTGAGGAGGTGG + Intronic
1094474780 12:30832842-30832864 TTTAGAGGAGCTGGGGGAGGAGG - Intergenic
1094614346 12:32022731-32022753 TACACAGAGGCTGGAGGAGGCGG - Intergenic
1094713000 12:32984275-32984297 CATAGAGGAGCTTGAGGAGGCGG - Intergenic
1095233380 12:39768579-39768601 AATAGAGAGGCTCCAGGAGAGGG + Intronic
1095573201 12:43705658-43705680 TATGCAGAGGCTGGAGGAGGTGG - Intergenic
1096045261 12:48556703-48556725 TATGAAGAGGCTGGAGGAGGTGG + Intergenic
1096296361 12:50387552-50387574 TATAGTGTGGCTTGAGGAGCTGG + Intronic
1096896259 12:54823131-54823153 TATAGACTGGCTTGAGGAGGTGG - Intergenic
1096939550 12:55327000-55327022 TATAGATGAGCTTGAGGAGGTGG - Intergenic
1097067753 12:56333394-56333416 TACAGAGGGCCTAGCGGAGGAGG - Intronic
1097245164 12:57604110-57604132 TAAAAAGTGGCTCGAGGTGGTGG - Intergenic
1097767452 12:63542447-63542469 TATAGACGAGCTTGAGGATGCGG - Intergenic
1097783823 12:63737490-63737512 TATAGACGAGCTTGAGGATGCGG - Intergenic
1099283488 12:80684235-80684257 TAGAGATGAGCTTGAGGAGGCGG + Intergenic
1100596452 12:96076606-96076628 TATAAAAGGGCTTGAGGGGGAGG - Intergenic
1100603380 12:96131317-96131339 TACAGATGAGCTTGAGGAGGTGG + Intergenic
1100815787 12:98385925-98385947 TATAGATGAGCTTGAGGAGGTGG - Intergenic
1102993858 12:117333509-117333531 CATTGAGGGGATCCAGGAGGTGG - Intronic
1103236590 12:119378045-119378067 TATAGAAAAGCTTGAGGAGGCGG + Intronic
1103868653 12:124074801-124074823 TATAGATGAGCTTGAGGAGGTGG + Intronic
1103907891 12:124336668-124336690 GATAAAGGGGCGCGAGAAGGAGG - Intronic
1104181399 12:126385333-126385355 TATAGATGAGCTTGAGGAGGTGG - Intergenic
1104187591 12:126447725-126447747 TATGTAGAGGCTGGAGGAGGCGG - Intergenic
1104706055 12:130948423-130948445 CATAGATGAGCTTGAGGAGGCGG - Intergenic
1104728101 12:131089899-131089921 TATAGAGGATCCAGAGGAGGAGG - Intronic
1106232581 13:27832656-27832678 TTTCCAGGGGCTGGAGGAGGTGG + Intergenic
1106472657 13:30071370-30071392 TATATAGAGGCTGGAGGAGGCGG + Intergenic
1106565927 13:30884665-30884687 TATAGAAAGGCTTGAGGAGGCGG + Intergenic
1107080310 13:36367440-36367462 TATGCAGAGGCTGGAGGAGGCGG - Intronic
1107159731 13:37211670-37211692 TATAGACAGGCTTGAGGAGGCGG + Intergenic
1107269004 13:38592678-38592700 TGTAGAGGGGTGTGAGGAGGTGG - Intergenic
1107976143 13:45690455-45690477 TGTGGAGGGGCTAGTGGAGGGGG + Intergenic
1108055343 13:46479676-46479698 TATAGAATGGCTTGGGGAGGGGG + Intergenic
1108397024 13:49999312-49999334 TGTACAGAGGCTTGAGGAGGTGG - Intronic
1108520781 13:51245144-51245166 TGTAGATGAGCTTGAGGAGGTGG + Intronic
1109179763 13:59199714-59199736 TATAAAAGGGCTTGAGGAAGTGG + Intergenic
1109807755 13:67466730-67466752 TATAGACGAGCTTGAGGAGGTGG + Intergenic
1110065114 13:71094940-71094962 TATAGGCAGGCTTGAGGAGGTGG + Intergenic
1110636114 13:77768514-77768536 TATAGAGGGGCTCGAGGAGGCGG - Intergenic
1110666695 13:78125444-78125466 TATAGGCAGGCTTGAGGAGGCGG + Intergenic
1111343505 13:86918833-86918855 TATAGACAGGCTTGAGGAGGTGG + Intergenic
1111649095 13:91067090-91067112 TATAGATGAGCTTGAGGAGGTGG + Intergenic
1112163224 13:96890442-96890464 TATAGATGAGCTTGAGGAGGTGG + Intergenic
1112397193 13:99043792-99043814 CATGGAGGGCCTCAAGGAGGGGG - Intronic
1113447419 13:110379935-110379957 CACAGAGGGGCTGGAGAAGGTGG - Intronic
1113915672 13:113871243-113871265 TATTGAGGGGCTAGCCGAGGTGG - Intergenic
1114196909 14:20486196-20486218 TATAGATAAGCTTGAGGAGGCGG - Intergenic
1115795767 14:36933711-36933733 TATCCTGGGGCTGGAGGAGGGGG - Intronic
1115799035 14:36971554-36971576 TATAGGGAGGCTTGAGGAGGTGG - Intronic
1116691005 14:48105648-48105670 TATAAACAGGCTGGAGGAGGTGG + Intergenic
1117350956 14:54881239-54881261 CATGGAGGGGCTATAGGAGGAGG + Intronic
1117416386 14:55500387-55500409 TATAAATGAGCTTGAGGAGGCGG - Intergenic
1117754930 14:58964904-58964926 TATAGAGGGGCTTGAGGAGGTGG - Intergenic
1117764486 14:59066801-59066823 AATAGAGAGGCCCGAGGAGAGGG + Intergenic
1117868588 14:60174668-60174690 TATAGACAGGCTTGAGGAGGCGG - Intergenic
1117887022 14:60375080-60375102 TATAGAGAGGCCCAAGGAGAGGG - Intergenic
1117976375 14:61300995-61301017 TATAGACTGGCTTGAGGAGGTGG - Intronic
1118980055 14:70709089-70709111 TATAGGCGAGCTTGAGGAGGTGG - Intergenic
1119091256 14:71783368-71783390 TATAGATGAGCTCGAGGAGGTGG - Intergenic
1119662072 14:76459311-76459333 TAGAGAGGAGCTGGAGTAGGTGG + Intronic
1121289008 14:92759345-92759367 TATAGTCAGGCTTGAGGAGGCGG + Intergenic
1122480898 14:102046653-102046675 TCGAGAGGCGCTCCAGGAGGGGG - Intronic
1122979383 14:105184789-105184811 TGGGGAGGGGCTCCAGGAGGGGG + Intergenic
1123039739 14:105485621-105485643 CTTAGAGGGGCGCCAGGAGGAGG + Intergenic
1126491651 15:49243482-49243504 CATAGAGGAGCTGGAGAAGGGGG - Intronic
1127005888 15:54569901-54569923 GATAGGAGGGCTGGAGGAGGTGG - Intronic
1127011960 15:54641149-54641171 TATAGGCAGGCTTGAGGAGGAGG - Intergenic
1127580877 15:60338383-60338405 TATAGAGGGGATTCAGGAAGAGG - Intergenic
1127851512 15:62916383-62916405 TATAGATGAGCTTCAGGAGGTGG - Intergenic
1128885215 15:71280279-71280301 TATAGAGGGCCTCAAACAGGAGG + Intronic
1129280541 15:74481409-74481431 TATGGAGGGGGACGGGGAGGTGG + Intergenic
1129699643 15:77760245-77760267 TATGGAGAGGCTCAAGGAGGTGG + Intronic
1130263943 15:82381609-82381631 TATTGGGAGGCTGGAGGAGGTGG - Intergenic
1130277087 15:82485982-82486004 TATTGGGAGGCTGGAGGAGGTGG + Intergenic
1130469449 15:84213332-84213354 TATTGGGAGGCTGGAGGAGGTGG + Intergenic
1130476939 15:84327896-84327918 TATTGGGAGGCTGGAGGAGGTGG + Intergenic
1130494826 15:84460234-84460256 TATTGGGAGGCTGGAGGAGGTGG - Intergenic
1130591743 15:85217961-85217983 TATTGGGAGGCTGGAGGAGGTGG + Intergenic
1131319058 15:91368724-91368746 TATAGACTGGCTTGAGGAGGCGG + Intergenic
1131533790 15:93216800-93216822 TACAAAGAGGCACGAGGAGGTGG - Intergenic
1131979038 15:97977935-97977957 TATACAGGAGCTTGAGGAGGCGG + Intergenic
1132049136 15:98592371-98592393 TAAGGAGGGGCTTGTGGAGGCGG - Intergenic
1132500013 16:280989-281011 GACAGAGGGGCTCCAGGCGGCGG - Intronic
1132869673 16:2110252-2110274 CATAGAGGGGCTGCAGGTGGTGG - Exonic
1133207871 16:4244665-4244687 TATAGTCAGGCTTGAGGAGGTGG - Intergenic
1133362820 16:5187448-5187470 TATAGACTGGTTTGAGGAGGCGG + Intergenic
1134001968 16:10789890-10789912 CAAAGAGGGGCAGGAGGAGGGGG + Intronic
1134376361 16:13678509-13678531 TATATAGAGGCTGAAGGAGGTGG + Intergenic
1134606694 16:15576960-15576982 TATAGACAAGCTTGAGGAGGTGG + Intronic
1134717745 16:16365350-16365372 CATAGAGGGGCTGCAGGTGGTGG + Intergenic
1134957007 16:18386809-18386831 CATAGAGGGGCTGCAGGTGGTGG - Intergenic
1136062512 16:27736464-27736486 TAAAGAGGGGACCGATGAGGTGG + Intronic
1136539902 16:30923514-30923536 TAAAGAGGGGGAGGAGGAGGAGG + Intronic
1137751369 16:50863448-50863470 TATAGATGGGGTGGGGGAGGCGG - Intergenic
1138746397 16:59367723-59367745 TATAGGCAGGCTTGAGGAGGTGG - Intergenic
1139122458 16:64036999-64037021 TATACATGAGCTTGAGGAGGTGG + Intergenic
1139167173 16:64580879-64580901 TGTACAGAGGCTTGAGGAGGAGG - Intergenic
1139583842 16:67888490-67888512 TAGAGCGGGGCTTGGGGAGGGGG + Intronic
1139956748 16:70696919-70696941 CAAAGAGGGGCTCTTGGAGGGGG - Intronic
1140533976 16:75692207-75692229 TATAGATGAGCTTGAGGGGGTGG - Intronic
1141093823 16:81148611-81148633 TCTAGAGGGGCTGGAGGCGAAGG + Intergenic
1141412681 16:83846108-83846130 TATAGACAGGCTTGAGGAGGGGG + Intergenic
1144177391 17:12720267-12720289 TGTACAGAGGCTTGAGGAGGCGG - Intronic
1145785326 17:27589856-27589878 TAAAGAGGGGGTTGAGGAGTTGG - Intronic
1146294906 17:31641853-31641875 TATAGATGAGCTTGAGAAGGCGG - Intergenic
1146803319 17:35844710-35844732 TATGGAGGAGACCGAGGAGGTGG + Exonic
1147042097 17:37727111-37727133 TATTGATTGGCTCGAGGAGGAGG - Intronic
1148735543 17:49862815-49862837 TACAGAGGGGCCCAAGGGGGTGG - Intergenic
1148807602 17:50272182-50272204 TGAAGAGGGGCAGGAGGAGGGGG - Intronic
1148827980 17:50408358-50408380 TATAGAGGGGCTGGATGCAGTGG + Intergenic
1150686127 17:67322346-67322368 TATAGGCAGGCTTGAGGAGGTGG - Intergenic
1151861575 17:76767683-76767705 TATGGAGGGGGTCGTGGAGATGG - Intronic
1153009883 18:528960-528982 TATAAATGAGCTTGAGGAGGCGG - Intergenic
1153844970 18:9041451-9041473 TATAGAGGGGCTGGGTGCGGTGG + Intergenic
1154257528 18:12796811-12796833 AATAGAAGGGCTAGAGGGGGTGG - Intronic
1155279773 18:24227679-24227701 GAGAGAGGTGCTCCAGGAGGCGG + Intronic
1155448931 18:25943282-25943304 TATAGACCAGCTTGAGGAGGTGG - Intergenic
1156291343 18:35751001-35751023 TATAGATGAGCTTGAGGAGGTGG + Intergenic
1156501825 18:37565077-37565099 GAGAGAGGGGATCGAGGAGACGG - Intronic
1156551759 18:38026317-38026339 TATAGATGAGCTTGAGGAGGCGG - Intergenic
1156643867 18:39135892-39135914 TATAGTCCGGCTTGAGGAGGCGG + Intergenic
1156715668 18:40006896-40006918 TATGGACAGGCTTGAGGAGGCGG - Intergenic
1157508689 18:48251792-48251814 TATAGGTGAGCTTGAGGAGGTGG - Intronic
1157740662 18:50089995-50090017 TAGAGAGAGGCTGAAGGAGGTGG - Intronic
1157774257 18:50379244-50379266 TAGAGAGGGGTGCTAGGAGGTGG + Intronic
1158089492 18:53694114-53694136 TATACAGAGGCTGGAGGAAGTGG + Intergenic
1158949328 18:62477599-62477621 TATAGAAGGGCTTGAGAAAGTGG + Intergenic
1159175953 18:64834090-64834112 TATAGATGGGCTCCTGTAGGTGG - Intergenic
1159180599 18:64897779-64897801 AATAGGAGGGCCCGAGGAGGGGG + Intergenic
1159200993 18:65183792-65183814 TGTAGTGGGGCGGGAGGAGGGGG + Intergenic
1159497951 18:69230357-69230379 TGTAGATGGGCTTGAGGAGGTGG + Intergenic
1159676309 18:71287923-71287945 TATAGATGAGCTTGAGGAGGTGG - Intergenic
1159707231 18:71706745-71706767 TATAGATGAACTTGAGGAGGTGG - Intergenic
1160114690 18:76066456-76066478 TATAGATGAGCTTGAGGAGCTGG + Intergenic
1160446415 18:78930777-78930799 AATACAGGGGCTCGATGACGGGG - Intergenic
1161273797 19:3404515-3404537 TGCAGAGGGGCTGGGGGAGGCGG + Intronic
1162227161 19:9232631-9232653 TATAGATAAGCTTGAGGAGGTGG - Intergenic
1162864814 19:13537795-13537817 TATAGACAGGCTTGAGGGGGCGG - Intronic
1163057865 19:14734840-14734862 TATAGACAGGCTTGAGAAGGCGG + Exonic
1163070622 19:14837660-14837682 TATAGAGGGGCTTGAGGAGGTGG - Intergenic
1164087227 19:21913883-21913905 TATAGATAAGCTTGAGGAGGTGG - Intergenic
1164178298 19:22797318-22797340 TTTAGAAAGGCTTGAGGAGGGGG - Intergenic
1164397291 19:27877319-27877341 TATGGGGAGGCTGGAGGAGGAGG - Intergenic
1164763659 19:30746580-30746602 TATAGACTGGCTTGAGGAGGTGG + Intergenic
1166318011 19:41999344-41999366 TGGAGAGGGGCTGGGGGAGGCGG - Intronic
1166426456 19:42683262-42683284 TATAGATGAGCTTGAGGAGGTGG + Intronic
1166563339 19:43747839-43747861 TCCAGAGGGGCTGGAGCAGGCGG + Exonic
1166917504 19:46205535-46205557 TATAGACGGGTTTGAAGAGGTGG - Intergenic
1167638891 19:50669293-50669315 GATACAGAGGCTCAAGGAGGGGG + Intronic
1168444252 19:56398166-56398188 TATAGACTGGCTTCAGGAGGTGG + Intronic
1168514580 19:57000827-57000849 TGTAGAGGGGCGTGAGAAGGAGG + Intergenic
925472436 2:4176497-4176519 TATAGTCTGGCTTGAGGAGGTGG + Intergenic
925601014 2:5608781-5608803 TGGAGATGGGCTGGAGGAGGAGG - Intergenic
927631385 2:24777168-24777190 TATAGATGAGCTTGAGGAAGAGG + Intergenic
929393013 2:41493773-41493795 TATAGATGAGCTTGAAGAGGTGG - Intergenic
931226175 2:60333968-60333990 CAAAGAGGGGCTCCAGGAGAAGG + Intergenic
931448506 2:62347558-62347580 TATAGGCAGGCTTGAGGAGGTGG + Intergenic
931687674 2:64808406-64808428 TATAGTCAGGCTTGAGGAGGTGG - Intergenic
932094681 2:68837171-68837193 AGTAGTGGGGCTCGAGGATGAGG + Intergenic
932286230 2:70534397-70534419 TGTAGAGGGGGATGAGGAGGAGG + Intronic
935364502 2:102275234-102275256 TATAGGCAGGCTTGAGGAGGTGG - Intergenic
935409950 2:102751239-102751261 TATAGACAGGCTTGAGGAGGCGG + Intronic
935782592 2:106521119-106521141 TATAGGCAGGCTTGAGGAGGTGG + Intergenic
935850851 2:107217161-107217183 TATAGACAGTCTTGAGGAGGCGG - Intergenic
936229631 2:110688775-110688797 TATTGGGAGGCTGGAGGAGGTGG - Intergenic
936411399 2:112261221-112261243 TATAGATGAGCTTGAGGAGCTGG - Intergenic
936771579 2:115920164-115920186 TATAGACTAGCTTGAGGAGGAGG + Intergenic
937404206 2:121611865-121611887 TAAAGAGGAACTGGAGGAGGAGG + Intronic
938009605 2:127818497-127818519 TATAGATGAGCTTGAAGAGGTGG - Intergenic
938575471 2:132599125-132599147 TATAAAGGGGGTGGAGGAAGCGG + Intronic
939353249 2:141068377-141068399 TATAGACAGGCTTGAGGAGGCGG + Intronic
939481185 2:142748813-142748835 TATAGACAGCCTGGAGGAGGCGG + Intergenic
939560258 2:143723327-143723349 GATGGAGGGGCTGAAGGAGGAGG + Intronic
940724167 2:157315957-157315979 CATACAGAGGCTTGAGGAGGCGG + Intergenic
940989208 2:160081053-160081075 TATAGATGAGCTTGAGGAGGTGG + Intergenic
940990339 2:160089454-160089476 TATAGATGAGCTTGAGGAGGTGG + Intergenic
943127066 2:183806856-183806878 TATAGACTGGCTTGAGGAGGTGG - Intergenic
943464985 2:188218046-188218068 TATTGAGAGGCTTGAGGAGGTGG - Intergenic
943713867 2:191128356-191128378 TATAGAGGGGAAGGAAGAGGAGG + Intronic
944036937 2:195305878-195305900 TATAGAGGGGCAAAAGGAGTTGG - Intergenic
944795265 2:203177729-203177751 TATAGAGGGGCTGGGTGTGGTGG + Intronic
945304130 2:208242563-208242585 TATAGATGGGCAGCAGGAGGAGG + Intronic
946126385 2:217566685-217566707 GATAGAGGAGGTGGAGGAGGAGG + Intronic
948808296 2:240462369-240462391 TGAAGAGGCGCTCGAGCAGGCGG - Exonic
948939349 2:241188335-241188357 CTTGGAGGGTCTCGAGGAGGTGG - Intergenic
1169410655 20:5366955-5366977 TATAGAGGGGCTGGGCGTGGTGG - Intergenic
1169983331 20:11412039-11412061 TATAGACAGGCTTGAGGAGGCGG - Intergenic
1170101165 20:12701046-12701068 TATTGGGAGGCTGGAGGAGGTGG - Intergenic
1170449079 20:16463092-16463114 TATAGATGAGCTTGAGGAGGTGG - Intronic
1170506851 20:17035413-17035435 TATAGGCAGGCTTGAGGAGGCGG + Intergenic
1170729297 20:18959139-18959161 TAGAGAGGGCCTCGTTGAGGAGG + Intergenic
1171251338 20:23651005-23651027 AATAGAGAGGCCCGAGGAGAGGG + Intergenic
1171253921 20:23671837-23671859 CATAGAGAGGCTAGGGGAGGAGG - Intergenic
1173125217 20:40330281-40330303 TATGAAGGGGCTGGAGGTGGAGG - Intergenic
1174056952 20:47804556-47804578 TATACAGAGGCTGGAGGGGGCGG - Intergenic
1175649598 20:60707866-60707888 AATAGGGGGGCTTGAGGAGAGGG - Intergenic
1176668808 21:9712702-9712724 TATAGGCAGGCTTGAGGAGGTGG - Intergenic
1178271498 21:31194025-31194047 TATAGCCAGGCTTGAGGAGGCGG - Intronic
1178325405 21:31641569-31641591 TATATAGAGGCTGGAGGAGGCGG + Intergenic
1178479599 21:32968153-32968175 TATAGATGAGCTTGAGGAGGCGG + Intergenic
1178529370 21:33362336-33362358 TATAGATGAGCTTGAGGAAGCGG + Intergenic
1178684384 21:34699874-34699896 TATAGACTGGCTTGAGGAGGTGG + Intronic
1178819717 21:35963966-35963988 TATAGTCAGGCTTGAGGAGGCGG + Intronic
1179634069 21:42696325-42696347 CAGAGAAGGGCTCCAGGAGGTGG - Intronic
1181336170 22:22131491-22131513 TATAAAGGAGCTTGAGGAGGTGG + Intergenic
1181682865 22:24507938-24507960 TATTGGGGGGCTGGAGGAGGTGG - Intronic
1181718361 22:24752501-24752523 TATAGAGGGGCTTGAGGAGGTGG - Intronic
1184579146 22:45401662-45401684 TATAGATGAGCTTGAGGAGGCGG - Intronic
949115473 3:315967-315989 TATAGACAGGCTTGAGGAGGTGG + Intronic
949336481 3:2980785-2980807 TATAGACAGGCTTGAGGAGGCGG + Intronic
949609137 3:5686201-5686223 TATAGACGAGCTTGAAGAGGTGG + Intergenic
950559852 3:13715076-13715098 TATTGAGGGGCCCAAGGTGGAGG + Intergenic
951342138 3:21501129-21501151 TATATAGAGGCTGGAGGAAGCGG - Intronic
953034056 3:39196505-39196527 CAGAGAGGTGCTCGGGGAGGGGG + Intergenic
953840231 3:46384162-46384184 TATAGACGAGCTTGAGGAAGTGG + Intergenic
955568625 3:60277656-60277678 TATAGGCAGGCTTGAGGAGGCGG - Intronic
956706298 3:72002051-72002073 TATAGATGAGTTTGAGGAGGTGG - Intergenic
956717699 3:72092790-72092812 ATTAGAGGGCCACGAGGAGGAGG + Intergenic
957227896 3:77473099-77473121 TATAGATGAGCTTGAGGATGCGG + Intronic
957274126 3:78068280-78068302 TATATAGAGGCTGCAGGAGGAGG + Intergenic
957791371 3:84945185-84945207 TAAAGAGAGGGTTGAGGAGGGGG - Intergenic
957910699 3:86617629-86617651 TATAGACAGGCTTGAGGAGGTGG - Intergenic
957911461 3:86624471-86624493 TATAGAGGGGCTTGAGGAGGCGG - Intergenic
958574258 3:95927134-95927156 TATACAGAGGCTGGAGGAGGCGG + Intergenic
959115852 3:102177431-102177453 TATAGATGAGCTTGAGGAGGCGG + Intronic
959341340 3:105135366-105135388 TATAAGGAGGCTGGAGGAGGTGG - Intergenic
959500544 3:107101814-107101836 TATAGATGAGCTTGAGGAGGTGG - Intergenic
959583189 3:108002639-108002661 TAAAGAGGTGCTCCTGGAGGAGG - Intergenic
959822849 3:110757041-110757063 TATACAGAGGCTGGAGGAGGCGG - Intergenic
960687593 3:120309734-120309756 TACGGATGGGCTTGAGGAGGTGG + Intergenic
961016440 3:123471869-123471891 TAGAGAGGGGAGGGAGGAGGCGG - Intergenic
961454662 3:127018051-127018073 TCTCGGGGGGCTCAAGGAGGTGG - Intronic
961800893 3:129448347-129448369 TATAGATAAGCTTGAGGAGGTGG + Intronic
963226428 3:142867127-142867149 TACTGGGAGGCTCGAGGAGGCGG - Intronic
963335721 3:143972023-143972045 TATAGAGGAGCGGGAGGGGGAGG - Exonic
963893182 3:150658596-150658618 TATAGACAGGCTTGAGGAGTCGG - Intergenic
964069145 3:152610901-152610923 TATAGACAGGCTTGAAGAGGTGG - Intergenic
964982663 3:162704875-162704897 TTAAGAGGAGCTGGAGGAGGAGG + Intergenic
965087381 3:164116120-164116142 TATAGATGAACTTGAGGAGGTGG - Intergenic
965438681 3:168685736-168685758 TATAGGGAGGCTTGAGGAGCAGG - Intergenic
966409467 3:179633469-179633491 TATAGACTAGCTTGAGGAGGTGG + Intergenic
968211126 3:196849662-196849684 TATAGTCTGGCTTGAGGAGGGGG - Intergenic
968359994 3:198139912-198139934 GATGGAGGGGCCAGAGGAGGAGG + Intergenic
968806772 4:2778635-2778657 TATAGATGGGCTTGAGGAAGCGG + Intergenic
968848391 4:3060920-3060942 TATAGACAGGCTTGAGGAGGTGG - Intergenic
969240574 4:5894420-5894442 TCTAGACTGGCTCGAGGAGGGGG - Intergenic
970900340 4:21151602-21151624 TTTAGATGGGCTCATGGAGGTGG - Intronic
971365002 4:25970570-25970592 TTTTGAGGGGCTGGAGGAGCTGG - Intergenic
972053590 4:34771833-34771855 TATAGGCAGGCTTGAGGAGGTGG - Intergenic
972297127 4:37750594-37750616 TATAAAAGGGCTTGAGGGGGTGG + Intergenic
972564759 4:40259813-40259835 TATAGGCAGGCTGGAGGAGGCGG + Intergenic
972683308 4:41327806-41327828 TATAGATGAACTTGAGGAGGTGG + Intergenic
973181775 4:47277370-47277392 TAGTGAGGGGCTGGGGGAGGCGG + Intronic
974043068 4:56874346-56874368 TATAGACAAGCTTGAGGAGGCGG + Intergenic
974604322 4:64130914-64130936 TATAGGCAGGCTTGAGGAGGTGG + Intergenic
975488725 4:74965361-74965383 TACAGATGGGCTAGAGCAGGTGG + Intronic
975583073 4:75924016-75924038 TATGGATGAGCTTGAGGAGGTGG - Intronic
976194951 4:82523297-82523319 TATACAGAGGTTGGAGGAGGCGG + Intronic
976267224 4:83195644-83195666 TATGTAGAGGCTGGAGGAGGTGG - Intergenic
977331322 4:95641109-95641131 TATCTATGGGCTGGAGGAGGAGG - Intergenic
977575591 4:98670738-98670760 TAGAGAGGTGCTCCAGGTGGTGG - Intergenic
977742363 4:100502102-100502124 AATAGAGGGGCTTGAGGAAGTGG + Intronic
978357395 4:107891674-107891696 TATAGATGAGCTTGAGGAGGTGG + Intronic
979872731 4:125845690-125845712 TATAGGCAGGCTTGAGGAGGTGG + Intergenic
979990058 4:127364785-127364807 TATAGACAGGCTTGAAGAGGTGG - Intergenic
980600846 4:135022276-135022298 TATTGTGAGGCTGGAGGAGGTGG - Intergenic
980689860 4:136281327-136281349 TATGTAGAGGCTGGAGGAGGTGG + Intergenic
981403357 4:144339702-144339724 TATACAGAGCCTGGAGGAGGCGG + Intergenic
981980368 4:150784601-150784623 TATGTAGAGGCTGGAGGAGGTGG - Intronic
982096922 4:151931692-151931714 TATAGACTGGCTTGAGGAGGTGG + Intergenic
982199134 4:152943166-152943188 GATGGAGGGGGTGGAGGAGGAGG - Exonic
982693322 4:158572082-158572104 TGTACAGAGGCTTGAGGAGGCGG - Intronic
984083342 4:175277821-175277843 TGTAGACAGGCTTGAGGAGGAGG + Intergenic
984133118 4:175902671-175902693 TATAGATGAGCTTGAGGAGGCGG - Intronic
984532717 4:180936442-180936464 AATAGAGGAGGTAGAGGAGGGGG + Intergenic
985345591 4:189001566-189001588 TATAGACAGGCTTGAGGAGGCGG - Intergenic
985405728 4:189636413-189636435 TATAGATAGGCTTGAGGAGGTGG - Intergenic
985482705 5:126885-126907 TATAGGCAGGCTTGAGGAGGTGG + Intergenic
985926164 5:3020755-3020777 TATAGATGAGCTTGAGGAGATGG - Intergenic
986268522 5:6211247-6211269 TATAGACAGGCTTGAGGAGGTGG + Intergenic
986948539 5:13053254-13053276 TATTGGGAGGCTGGAGGAGGCGG - Intergenic
987135575 5:14896830-14896852 TATAGATGAGCTTGAGGAGGTGG + Intergenic
987389310 5:17361039-17361061 TATAGGTAGGCTTGAGGAGGCGG + Intergenic
988255650 5:28817251-28817273 TATAGATGAGTTTGAGGAGGTGG + Intergenic
988476127 5:31587653-31587675 TATAGATGGGTTTGAGGAGGCGG + Intergenic
988633082 5:32952014-32952036 TATAGGCAGGCTTGAGGAGGTGG + Intergenic
988662350 5:33285601-33285623 TATAAAAGGGCTTGAGGATGTGG + Intergenic
989189901 5:38660514-38660536 TATAGACGAGCTTGAGGAGGCGG - Intergenic
990681059 5:58244963-58244985 GCTAGAGGGGATTGAGGAGGTGG + Intergenic
992855720 5:80859411-80859433 TATGGAGGGGCTAGGTGAGGTGG - Intronic
995060278 5:107805950-107805972 TTCAGATGGGCTCCAGGAGGCGG - Intergenic
995106433 5:108381691-108381713 TATAGAAGGCCCCGAGGAGGGGG + Exonic
995163991 5:109015858-109015880 TATGGAGGGGAATGAGGAGGTGG - Intronic
995183668 5:109250924-109250946 TACAAAGAGGCTAGAGGAGGAGG - Intergenic
995581302 5:113605996-113606018 TGTAGATGAGCTTGAGGAGGTGG - Intergenic
995827272 5:116314703-116314725 TATAGGCAGGCTTGAGGAGGTGG + Intronic
995881690 5:116850837-116850859 TATAAATGAGCTTGAGGAGGCGG + Intergenic
995953693 5:117748328-117748350 TCTACAGGGGCTTGAGGAGGAGG + Intergenic
995966398 5:117912367-117912389 TATAGGCAGGCTTGAGGAGGCGG + Intergenic
996051603 5:118941094-118941116 TTTAGATAGGCTCTAGGAGGGGG - Intronic
996395012 5:123004851-123004873 GGTAGAGGGGCTCGTGGAGAGGG - Intronic
997018897 5:129973056-129973078 TATTGAGGGGATAGAGGAGCAGG - Intronic
997230879 5:132242111-132242133 TATAGAGAGGCTTGAGGAGGCGG - Intronic
999243650 5:150141686-150141708 TATTGAGGGGCTGGAGAGGGAGG + Intronic
999589596 5:153130539-153130561 TACAGACTGGCTTGAGGAGGTGG - Intergenic
1004073761 6:12326621-12326643 TATAGATGAGCTTGAGGAGGTGG - Intergenic
1004232667 6:13847099-13847121 TATGGAGGAGGTAGAGGAGGTGG + Intergenic
1004368726 6:15033923-15033945 TATAGGCAGGCTTGAGGAGGCGG + Intergenic
1005047239 6:21653940-21653962 TATGAAGAGGCTGGAGGAGGCGG + Intergenic
1005165613 6:22916792-22916814 TATAGATGAGCTTGAGGAGGTGG + Intergenic
1006833760 6:36985007-36985029 TAGAGAGGGGAGCTAGGAGGAGG - Intronic
1006911134 6:37564383-37564405 GATAGAGGGGCTCTTGAAGGAGG - Intergenic
1008259074 6:49342749-49342771 TGTACAGAGGCTTGAGGAGGTGG - Intergenic
1011128824 6:84033998-84034020 TTTAGAGGGGCTAGAGAATGGGG + Intronic
1011888498 6:92127382-92127404 TATAGGCAGGCTTGAGGAGGTGG - Intergenic
1013224320 6:108109201-108109223 TATAAAGGGGCTTGAGGAAATGG - Intronic
1014291821 6:119566995-119567017 TATAGACAGGCTTGAGGAGGCGG - Intergenic
1015515594 6:134079806-134079828 TACAGACAGGCTTGAGGAGGTGG - Intergenic
1016733188 6:147448516-147448538 TACACAGAGGCTGGAGGAGGCGG - Intergenic
1018040298 6:159915891-159915913 TATTGAGGGGCAGGAGGTGGGGG - Exonic
1019259994 7:76708-76730 GATGGAGGGGCCAGAGGAGGAGG - Intergenic
1020654042 7:10908838-10908860 TGTAAAGAGGCTTGAGGAGGCGG - Intergenic
1021101327 7:16587944-16587966 TACAGACAGGCTTGAGGAGGAGG + Intergenic
1021133770 7:16942594-16942616 TATAGACAGGTTTGAGGAGGTGG - Intergenic
1021794120 7:24236391-24236413 TACAGATGAGCTTGAGGAGGTGG + Intergenic
1022304828 7:29137316-29137338 TATAGACAGGCTTGAGGAGGTGG + Intronic
1022642468 7:32201301-32201323 TATTGAGAGGATAGAGGAGGAGG + Intronic
1022716996 7:32907615-32907637 TATAGATGAGCTTGAGGAGGTGG + Intergenic
1023076304 7:36486090-36486112 TGGAGATGGGCTGGAGGAGGGGG - Intergenic
1023392326 7:39722156-39722178 TATAGTCCGGCTTGAGGAGGCGG + Intergenic
1023733996 7:43218991-43219013 TATAAACAGGCTGGAGGAGGTGG + Intronic
1023972103 7:44999621-44999643 GAAGGAGGGGCGCGAGGAGGCGG - Intronic
1024432091 7:49300844-49300866 TATAGGGAGGCTAGAGGAGGCGG + Intergenic
1024770175 7:52713193-52713215 TATAGAGGGACTTGAGGAGGTGG - Intergenic
1024770477 7:52715810-52715832 TATAGACAGGCTTGAGGAGGTGG + Intergenic
1024795645 7:53016620-53016642 TATAGGGTGGCTTGGGGAGGTGG - Intergenic
1025236060 7:57235622-57235644 TATACAGAGGCTGGAGGAGGCGG + Intergenic
1025796482 7:64742395-64742417 TATAGATGTGCTTGAGGAGGTGG - Intergenic
1026117555 7:67508839-67508861 TATAGATAAGCTTGAGGAGGTGG + Intergenic
1026211634 7:68311127-68311149 TATAGACTAGCTTGAGGAGGTGG + Intergenic
1026214716 7:68338169-68338191 TATAGACAGGCTTGAGGAGGTGG + Intergenic
1026222422 7:68412059-68412081 TATAGACAGGCTTGAGGAGGTGG - Intergenic
1026276521 7:68882530-68882552 TATAGATGAGCTTGAGGAGGTGG - Intergenic
1026349270 7:69501610-69501632 TATAGATGAGCTTGAGGAGGTGG - Intergenic
1026519950 7:71107941-71107963 TATAGATGAGCTTGAGGAGGTGG - Intergenic
1028229336 7:88287620-88287642 TATAGAGGGGATCGCAGAAGTGG + Intronic
1028251013 7:88540148-88540170 TATAGTCTGGCTTGAGGAGGTGG + Intergenic
1028469358 7:91187734-91187756 TATAGGCAGGCTTGAGGAGGCGG + Intronic
1029147392 7:98456566-98456588 GATTGAGGGGCTCAGGGAGGAGG + Intergenic
1030782335 7:113617079-113617101 TATAGATAGGCTTGAGGAGGTGG - Intergenic
1031344962 7:120653331-120653353 TAAAGAGGGGCCCGATGTGGTGG - Intronic
1031356202 7:120790043-120790065 TAAAGATGAGCTTGAGGAGGCGG - Intronic
1031424189 7:121585767-121585789 TATAGATGAGCTTGAGGAGGCGG - Intergenic
1032956522 7:136978061-136978083 TAGAGAGGGGGTGGAGGAGGGGG + Intronic
1033451832 7:141468849-141468871 TATAGACCGGCTTGAGGTGGCGG + Intronic
1033626725 7:143117637-143117659 TTTAGATGAGCTTGAGGAGGCGG - Intergenic
1033667920 7:143460996-143461018 TATAGATGAGCTTGAGGAGGTGG + Intergenic
1034160456 7:148990646-148990668 TATAGGCAGGCTTGAGGAGGCGG - Intergenic
1034180343 7:149132573-149132595 TATAGGCAGGCTTGAGGAGGCGG + Intronic
1035703724 8:1658026-1658048 TGTACAGAGGCTTGAGGAGGTGG + Intronic
1036044761 8:5127326-5127348 TATAGATGAGCTTGAGGAGGTGG - Intergenic
1036382429 8:8245716-8245738 TATAGATGAGCTTGAGGAGGTGG - Intergenic
1036425081 8:8637556-8637578 TATAGATGAGCTTGAGGAGGTGG - Intergenic
1036515338 8:9438545-9438567 TATAGACAGGCTTGAGGAGGTGG + Intergenic
1036773871 8:11596816-11596838 TATACACGGGCTTGAGGATGGGG - Intergenic
1036916914 8:12812957-12812979 TATAGATGAGCTTGAGGAGGCGG - Intergenic
1037032906 8:14130995-14131017 TATAGATGAGTTTGAGGAGGTGG - Intronic
1037216844 8:16464744-16464766 TATAGACAAGCTTGAGGAGGTGG - Intronic
1037221553 8:16528743-16528765 TATAGACAGGCTTGAGGAAGTGG + Intronic
1037566595 8:20123339-20123361 AATAGAGGGGCTTTGGGAGGTGG - Intergenic
1037764885 8:21766624-21766646 GAAAGAGGGGCTCAAGGGGGAGG - Intronic
1037940983 8:22950666-22950688 TATAGACTGGCTTGAGGAGGTGG + Intronic
1038339005 8:26668604-26668626 TACAGATGAGCTTGAGGAGGCGG - Intergenic
1038348272 8:26752251-26752273 TATAGATGAGCTTGAGGAGGCGG + Intronic
1038873578 8:31522608-31522630 TATACAGAGGCTGGAGGAGGTGG + Intergenic
1038983696 8:32786235-32786257 TATACAGAGGCTTGAGGAGGTGG + Intergenic
1039418585 8:37417255-37417277 AACAGAGAGGCTGGAGGAGGGGG - Intergenic
1039716298 8:40113261-40113283 TATAGTCGAGCTTGAGGAGGTGG - Intergenic
1039966221 8:42285903-42285925 ACTAGAGGGGCTCGGGGAGTAGG + Intronic
1040003090 8:42595681-42595703 TATAGAGAGGCTGGACGTGGTGG + Intergenic
1040356863 8:46626983-46627005 TATAGACAGGCTTGAGGAGGCGG - Intergenic
1040423634 8:47262727-47262749 TATAGAGGGTCCCCAGGAGGTGG + Intronic
1040779646 8:51092884-51092906 TATAGATGAGCTTGACGAGGTGG - Intergenic
1040957593 8:52995543-52995565 TATAGACAGGCTTGAGGAGGCGG - Intergenic
1041182225 8:55260644-55260666 TATAGACAGGCTTGAGGAGGTGG + Intronic
1041597767 8:59677107-59677129 TATAGACTAGCTTGAGGAGGTGG - Intergenic
1042397634 8:68310780-68310802 TATAGACTGGCTTGAGGAGGTGG + Intronic
1042411641 8:68473270-68473292 TATAGACAGGCTTGAGGAGGTGG + Intronic
1042442882 8:68848457-68848479 TATGTAGAGGCTGGAGGAGGTGG - Intergenic
1042710917 8:71716289-71716311 TACAGAGGGGCTTGAGGAGGAGG + Intergenic
1043492970 8:80767807-80767829 TATAGAGGGTTTCAAGGAGAAGG - Intronic
1044003234 8:86910890-86910912 TATAGATGAGCTTGAGGAGGTGG + Intronic
1044301657 8:90591334-90591356 TATAGACCGGCTTGAGAAGGTGG - Intergenic
1044865791 8:96569835-96569857 TTTAGAGTGGCTCCTGGAGGCGG + Intronic
1044945293 8:97383634-97383656 TATAGACAGGCTTGAGGAGATGG + Intergenic
1046770766 8:118113970-118113992 TATAGAGGGGCCAGGCGAGGTGG - Intergenic
1047238781 8:123066164-123066186 TATAGAAAGTCTTGAGGAGGTGG + Intronic
1047284955 8:123479906-123479928 TATACAGAGGCTGGAGGAGGCGG - Intergenic
1048291529 8:133185167-133185189 CAGAGAGGGGCTGGTGGAGGGGG - Intergenic
1049148159 8:141017239-141017261 TTTATGGGGGCTGGAGGAGGCGG - Intergenic
1050196400 9:3088423-3088445 TATAGATGAGCTTGAGGAGGCGG - Intergenic
1050829910 9:9998001-9998023 TATTGAGAGGCTGGAGGAGAAGG - Intronic
1050910644 9:11065220-11065242 TATATATGGGCTTGAGGAAGTGG - Intergenic
1051076109 9:13238422-13238444 TATAGGCGGGCTTGAGAAGGGGG - Intronic
1051219924 9:14837264-14837286 TATGCAGAGGCTGGAGGAGGTGG - Intronic
1052371109 9:27665425-27665447 TATAGATGAGCTTGAGGAGAAGG - Intergenic
1052677961 9:31651131-31651153 TCTAGAGGAGCTTGAGGAGACGG + Intergenic
1053054998 9:34988904-34988926 TGAAGAGGGGCGCGAGGATGAGG + Intergenic
1053356469 9:37450084-37450106 TATAGGCAGGCTTGAGGAGGTGG - Intronic
1055443966 9:76364455-76364477 TATAGAGGAGCTGGAGGAGGTGG - Intergenic
1055463623 9:76542560-76542582 TATAGACAGGCGTGAGGAGGCGG - Intergenic
1055510715 9:76993301-76993323 TATAGATGAGCTTGGGGAGGCGG + Intergenic
1057073111 9:92117602-92117624 TATAGATGAGCTTGAGGAAGTGG - Intergenic
1057484119 9:95468819-95468841 TACAGGGGGGCTCGAGGCAGTGG + Exonic
1058049958 9:100395516-100395538 TATAGACAGGCTTGAGGAGGTGG + Intergenic
1059142624 9:111868719-111868741 TATAGATGAGCTTAAGGAGGCGG - Intergenic
1060285881 9:122251948-122251970 TCTGGAGGAGCTTGAGGAGGTGG + Exonic
1061554496 9:131358639-131358661 TACAGAGGGGCTTGAAGAGGTGG + Intergenic
1062035138 9:134379624-134379646 CAGAGAGGGGCTGGAGCAGGAGG - Intronic
1062744702 9:138203753-138203775 GATGGAGGGGCCAGAGGAGGAGG + Intergenic
1203657058 Un_KI270753v1:8239-8261 TATAGGTAGGCTTGAGGAGGTGG + Intergenic
1185889012 X:3807990-3808012 TATAGATGAGCTTGATGAGGTGG + Intergenic
1186055141 X:5642218-5642240 TATAAGGAGGCTGGAGGAGGCGG - Intergenic
1186704929 X:12131002-12131024 TATGGAGAGGCACGGGGAGGAGG - Intergenic
1186812250 X:13201878-13201900 TATAGATGAGCTTGAAGAGGCGG + Intergenic
1187056755 X:15747999-15748021 TATAGGCAGGCTTGAGGAGGCGG + Intronic
1187195328 X:17077994-17078016 TGTAGTGGGGCTGGAGGTGGGGG + Intronic
1187941580 X:24387841-24387863 CATAGATGAGCTTGAGGAGGCGG + Intergenic
1188159007 X:26777725-26777747 TGTAGACTGGCTTGAGGAGGCGG + Intergenic
1188159736 X:26784631-26784653 TATAGACTGGCTTGAGGAGGTGG + Intergenic
1188181195 X:27057981-27058003 TGCAGAGAGGCTTGAGGAGGTGG + Intergenic
1188518720 X:31014533-31014555 TATGCAGAGGCTGGAGGAGGTGG + Intergenic
1188964494 X:36534973-36534995 TATAGATGAGCTTGAGGAGGTGG + Intergenic
1189580795 X:42404216-42404238 TATAGTCAGGCTAGAGGAGGTGG + Intergenic
1189863695 X:45300748-45300770 TATAGACAGGCTTGAGGAAGTGG + Intergenic
1190539435 X:51461950-51461972 TATTGGGAGGCTGGAGGAGGCGG - Intergenic
1191609736 X:63100115-63100137 TACAGAAAGGCTTGAGGAGGTGG + Intergenic
1192777507 X:74260271-74260293 TATGCAGAGGCTGGAGGAGGCGG - Intergenic
1195334092 X:103832301-103832323 GAGAAAGGGGCACGAGGAGGCGG - Intergenic
1196976264 X:121161180-121161202 TATAGAAGGACTAGAGGAGTTGG - Intergenic
1197662391 X:129188247-129188269 TATGTAGAGGCTGGAGGAGGCGG + Intergenic
1199541852 X:148966449-148966471 TATAGAGAGGAGAGAGGAGGAGG - Intronic
1201276667 Y:12304917-12304939 TATAGATGAGCTTGAGGAGGTGG - Intergenic
1201294223 Y:12449975-12449997 TATAGGCAGGCTGGAGGAGGCGG - Intergenic
1201925587 Y:19283793-19283815 TATAGATGAGCTTGAAGAGGTGG - Intergenic