ID: 1110636118

View in Genome Browser
Species Human (GRCh38)
Location 13:77768528-77768550
Sequence GATGCGGTTGGTTTTATAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 2, 2: 4, 3: 17, 4: 100}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110636118_1110636130 27 Left 1110636118 13:77768528-77768550 CCCTCTATAAAACCAACCGCATC 0: 1
1: 2
2: 4
3: 17
4: 100
Right 1110636130 13:77768578-77768600 AATCCCCCTCCCTCTACATGGGG 0: 1
1: 0
2: 2
3: 28
4: 233
1110636118_1110636129 26 Left 1110636118 13:77768528-77768550 CCCTCTATAAAACCAACCGCATC 0: 1
1: 2
2: 4
3: 17
4: 100
Right 1110636129 13:77768577-77768599 GAATCCCCCTCCCTCTACATGGG 0: 1
1: 0
2: 2
3: 12
4: 118
1110636118_1110636121 -9 Left 1110636118 13:77768528-77768550 CCCTCTATAAAACCAACCGCATC 0: 1
1: 2
2: 4
3: 17
4: 100
Right 1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 31
1110636118_1110636128 25 Left 1110636118 13:77768528-77768550 CCCTCTATAAAACCAACCGCATC 0: 1
1: 2
2: 4
3: 17
4: 100
Right 1110636128 13:77768576-77768598 GGAATCCCCCTCCCTCTACATGG 0: 1
1: 0
2: 1
3: 13
4: 144
1110636118_1110636126 4 Left 1110636118 13:77768528-77768550 CCCTCTATAAAACCAACCGCATC 0: 1
1: 2
2: 4
3: 17
4: 100
Right 1110636126 13:77768555-77768577 TGCTAACAGGGAGATCCATTCGG 0: 1
1: 0
2: 3
3: 10
4: 96
1110636118_1110636122 -8 Left 1110636118 13:77768528-77768550 CCCTCTATAAAACCAACCGCATC 0: 1
1: 2
2: 4
3: 17
4: 100
Right 1110636122 13:77768543-77768565 ACCGCATCCCGCTGCTAACAGGG 0: 1
1: 0
2: 0
3: 7
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110636118 Original CRISPR GATGCGGTTGGTTTTATAGA GGG (reversed) Intergenic
909701332 1:78526902-78526924 GATGCAATCTGTTTTATAGAAGG + Intronic
910030665 1:82718187-82718209 GATGTTGTTGGTTTTGAAGATGG + Intergenic
914995157 1:152537141-152537163 AATGCTGCTGGTTTTATAAATGG - Intronic
917690408 1:177462578-177462600 GATGGGTTAGGTTTTACAGATGG + Intergenic
919472571 1:197997541-197997563 GATGAGGTAGGTTTTAAAGGGGG + Intergenic
921574182 1:216815162-216815184 AATGCTTTTGGTTTTATATATGG - Intronic
922079711 1:222283923-222283945 TATGAGGTGGGTTATATAGACGG + Intergenic
922887438 1:229031014-229031036 GATGCAGTTGATTATATAGAGGG - Intergenic
923702864 1:236316561-236316583 GTTGTTGTTGGTTTTAGAGATGG + Intergenic
1062921287 10:1281772-1281794 GATGGGGTTGGCTTTTTAAACGG - Intronic
1063181965 10:3610640-3610662 GGTGATGTTGGTTTTATAAAAGG - Intergenic
1070740324 10:78899032-78899054 GAGCGGGTTGGTTTTACAGATGG - Intergenic
1074623251 10:115149033-115149055 GCTGTGGTTGGTTTTATAGAGGG + Intronic
1078068811 11:8095204-8095226 TGTGCAGTTGGTTTTGTAGATGG + Intronic
1079656242 11:22989217-22989239 GATCCTGATGGTTTTATAAAGGG - Intergenic
1083517969 11:63278425-63278447 GTTGGGGTTGGGTTTTTAGAAGG + Intronic
1085135595 11:74084603-74084625 GAAGAGGTTGATTTTATAGATGG - Intronic
1085679266 11:78556096-78556118 TATGTGGTTGGTTTTAGAGTAGG + Intronic
1085679305 11:78556611-78556633 GAAGAGGCTAGTTTTATAGATGG - Intronic
1089868554 11:121652537-121652559 GATGCTGTTGGTTTTCCAGAAGG - Intergenic
1090324547 11:125873801-125873823 GAAGCGGCTGGTTTTATAGAGGG - Intergenic
1090878333 11:130811403-130811425 AATGCAGAAGGTTTTATAGAGGG + Intergenic
1093818838 12:23586003-23586025 GATGTGGTCCATTTTATAGAGGG - Intronic
1106304407 13:28496557-28496579 GATGCTGTGGGTTTTAGAGGAGG - Intergenic
1109397898 13:61784689-61784711 GATGTTGTTTATTTTATAGAAGG - Intergenic
1110636118 13:77768528-77768550 GATGCGGTTGGTTTTATAGAGGG - Intergenic
1111936116 13:94558482-94558504 GATAAGGTTGGTCTTATACAGGG - Intergenic
1112849176 13:103683301-103683323 GATGGGGATGTTTTTATAGAAGG + Intergenic
1117754934 14:58964918-58964940 GGTGTGGTTGATTTTATAGAGGG - Intergenic
1118134560 14:63008484-63008506 GCTTAGGTTGGTGTTATAGAAGG - Intronic
1121986469 14:98511654-98511676 TATGGTGATGGTTTTATAGATGG + Intergenic
1132609784 16:809706-809728 GAGGAGGCTGGTTTTCTAGACGG + Intronic
1133602055 16:7349298-7349320 CATGCGTTTGGTTTGAGAGAAGG - Intronic
1140134138 16:72190232-72190254 GAGGGGGTTGGTTTTAGGGACGG + Intergenic
1141024938 16:80537659-80537681 GATGCTGTTTTTTTTATTGAAGG + Intergenic
1148642368 17:49197647-49197669 GAGGAGGTTGGTTTTAGGGAGGG + Intergenic
1149526331 17:57358908-57358930 TTTGAGATTGGTTTTATAGAGGG + Intronic
1149526335 17:57358944-57358966 TTTGCGATTGGTTTTATAGAGGG + Intronic
1155254158 18:23979986-23980008 GATGCTGTTGGCTTTGAAGATGG + Intergenic
1160489001 18:79320850-79320872 GATGCTGTGGGTTTTATACTGGG + Intronic
1160972567 19:1776006-1776028 GGTGGGGTTGGTTTTGGAGAGGG - Exonic
1163070626 19:14837674-14837696 GATTCGGTTGGTTTTATAGAGGG - Intergenic
927087068 2:19682777-19682799 GATGTGGATGGTTGGATAGATGG + Intergenic
928784260 2:34863135-34863157 GCTGTGGTTGTTTTTATAGAGGG + Intergenic
931254384 2:60557002-60557024 GATGCAGGTGGTTTTGTAGAGGG + Intergenic
931933268 2:67165571-67165593 TATGTGGTTTGTTTTATAGCTGG - Intergenic
938747606 2:134294526-134294548 CAAGGGCTTGGTTTTATAGAAGG + Intronic
939257978 2:139769580-139769602 GATGAGGGTAGTTTTATAGGTGG + Intergenic
940061380 2:149573425-149573447 GAGGAGGTTGGCTTTATAGGCGG - Intronic
940481050 2:154231415-154231437 GATGATGTTGCTCTTATAGATGG + Intronic
943716600 2:191159604-191159626 GATGAAATTGGTTTTATAGTTGG + Intergenic
944005722 2:194902998-194903020 GATGAGGCTGGTTTTATGGGTGG + Intergenic
945082595 2:206101035-206101057 TATGCTGTTGGCTTTAAAGATGG - Intergenic
948229106 2:236336721-236336743 GGTGCTGTTGGTGTTACAGATGG - Intronic
1170025274 20:11882406-11882428 GATGATGTTGGTTTTAAATAAGG + Intergenic
1174661090 20:52213830-52213852 GATGCTGTTGGCTTTGAAGATGG - Intergenic
1174945595 20:54981807-54981829 GATGAGGATGGTATTATATAGGG + Intergenic
1177741534 21:25159806-25159828 TATGCTGTTGGGTCTATAGAAGG - Intergenic
1181718365 22:24752515-24752537 GATGCAGTTGGTTTTATAGAGGG - Intronic
1182911262 22:33986596-33986618 GAGGCGGTGGGTTTTAAAGAGGG + Intergenic
950849260 3:16047047-16047069 GATACGATAGTTTTTATAGATGG - Intergenic
954177959 3:48859200-48859222 GCTGTGGTTGGTGTTATACAGGG - Exonic
956269317 3:67433170-67433192 TATGGGGTAGCTTTTATAGAAGG - Intronic
957911465 3:86624485-86624507 GATTTGGTTGATTTTATAGAGGG - Intergenic
959540993 3:107538650-107538672 GTGGCTGTTGGTTTTACAGATGG + Intronic
960687589 3:120309720-120309742 GATGCGGCTGGTTTTACGGATGG + Intergenic
962160619 3:132995876-132995898 GATGTGGATGGTTTTGTAAATGG - Intergenic
963134478 3:141888764-141888786 GATCTGGTGGGTTTTATAAATGG + Intronic
964272437 3:154972056-154972078 GAAGGGTTTGGTTTTATAGACGG + Intergenic
965183652 3:165436001-165436023 GAGGAGGTTAGTTTTAGAGAGGG - Intergenic
966098445 3:176236217-176236239 GATGAGGTTGGTTTAAGGGATGG - Intergenic
966852208 3:184171171-184171193 GATGGGGTGGGGTTAATAGAGGG - Exonic
967228033 3:187312002-187312024 GAGGGGGTGGGGTTTATAGAGGG + Intergenic
970361077 4:15309483-15309505 GATGCTGATGGTTTTAAAAATGG - Intergenic
972013958 4:34220557-34220579 AATGCGGCTGGTTTGATGGATGG + Intergenic
972960366 4:44447025-44447047 GTTACGGGTGGTTTTCTAGAGGG - Intronic
977742360 4:100502088-100502110 GATGCAGTGGGCTTAATAGAGGG + Intronic
980641096 4:135580996-135581018 AATGGTGTTTGTTTTATAGATGG + Intergenic
981704017 4:147640394-147640416 GGTTTGGTTGGTTATATAGAAGG - Intronic
984280237 4:177661987-177662009 GATCCTGATGGTTTTATAAAGGG + Intergenic
987005784 5:13707737-13707759 CATGATGTTGGTTTCATAGAAGG - Intronic
989450856 5:41585195-41585217 GATGTGGAAGGTTTTAGAGATGG - Intergenic
997151258 5:131498426-131498448 GATAAGGTTGGTTTTATAAGGGG - Exonic
1001704175 5:173729886-173729908 GATCAGGATGGTTTGATAGAGGG - Intergenic
1005237503 6:23782172-23782194 AATGCAGTTGGTTTTATTCAGGG + Intergenic
1009443503 6:63711565-63711587 GATGTTTTTGGTTTTATACAGGG + Exonic
1009572426 6:65404169-65404191 AATGAGGCTGGTTTTAAAGATGG - Intronic
1009814919 6:68720608-68720630 AATGCACTTGGTTTTATAAATGG - Intronic
1018796078 6:167186622-167186644 GATGCTGTTGCTATGATAGATGG + Intronic
1020395858 7:7716946-7716968 GAAGAGGTTGGTTTTATAGGAGG - Intronic
1020557463 7:9688905-9688927 GATCCAGTTGGTTTTATTTAAGG - Intergenic
1021003761 7:15367988-15368010 GATGGGGCTGGTTTTTAAGAAGG - Intronic
1023182287 7:37496979-37497001 GATGTTGGTGGTTTTAAAGATGG + Intergenic
1023250790 7:38258785-38258807 GAAGCAGATGGTTTTATAGGTGG + Intergenic
1023252334 7:38278409-38278431 GAAGCAGATGGTTTTATAGGTGG + Intergenic
1023364834 7:39453135-39453157 GATGCTGTTGATCTTAAAGATGG + Intronic
1024626715 7:51213935-51213957 AATGCGGATGCCTTTATAGAAGG - Intronic
1024770178 7:52713207-52713229 TATGCAGTTGGTTTTATAGAGGG - Intergenic
1025039873 7:55632413-55632435 GTTGAGGTTGGTTTCATAAAAGG + Intergenic
1029333878 7:99883542-99883564 GATGCAGTTGACTTTATAGAGGG + Intronic
1030684530 7:112471039-112471061 GATGCTGATGACTTTATAGAGGG + Intronic
1030831117 7:114222732-114222754 GATGGGGTAGCTTTTAAAGAAGG + Intronic
1034914729 7:155027448-155027470 GTTGCAGTTGTTTTTAAAGATGG - Intergenic
1035168192 7:157003789-157003811 GATGAGGTTGATTTTATGGAAGG + Intronic
1037822624 8:22142229-22142251 GATGCGGTTGGTGGGGTAGAGGG + Intergenic
1038552526 8:28482325-28482347 GATGAGGTCAGTTTTATATATGG + Intronic
1038823345 8:30973890-30973912 GACAAGTTTGGTTTTATAGACGG - Intergenic
1040447710 8:47512251-47512273 GTTGAGGATGGTTTAATAGAGGG + Intronic
1042710913 8:71716275-71716297 GATGCGGTCTATTTTACAGAGGG + Intergenic
1043946106 8:86254524-86254546 GAAGGGATTGGTTTTCTAGATGG - Intronic
1044581320 8:93829073-93829095 CATGCGGTTGGTTCTATTTATGG + Intergenic
1045817751 8:106296559-106296581 TATGGGGCTGGTTTTATAGGTGG - Intronic
1046275783 8:111958262-111958284 GATGAGTATGGTGTTATAGATGG + Intergenic
1054734481 9:68736665-68736687 GATGCTGCTGGCTTTAAAGATGG - Intronic
1056964343 9:91153434-91153456 GAGGGGGTTAGTTTTATGGAGGG + Intergenic
1060330991 9:122670163-122670185 GATGTGGTCGATTTTATAGAGGG - Intergenic
1060964159 9:127703081-127703103 GAGGAGGCTGGTTTTACAGATGG - Intronic
1061554493 9:131358625-131358647 GATGTGGTTGGTTTTACAGAGGG + Intergenic
1185981158 X:4780583-4780605 GATGGAGTTGGTTTTGGAGAAGG - Intergenic
1186133457 X:6494555-6494577 GATGGTTTTGGTTTTATAAATGG - Intergenic
1186435022 X:9535319-9535341 GATGTGGTTCTGTTTATAGAGGG + Intronic
1190531051 X:51376776-51376798 GATGTTGTTTGGTTTATAGATGG - Intergenic
1195028846 X:100906865-100906887 TATGCTGTTGGTTTTAAAGATGG - Intergenic
1200753773 Y:6970872-6970894 GATGTGGTTCAGTTTATAGAGGG + Intronic