ID: 1110636119

View in Genome Browser
Species Human (GRCh38)
Location 13:77768529-77768551
Sequence GGATGCGGTTGGTTTTATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 3, 2: 5, 3: 8, 4: 66}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110636119_1110636128 24 Left 1110636119 13:77768529-77768551 CCTCTATAAAACCAACCGCATCC 0: 1
1: 3
2: 5
3: 8
4: 66
Right 1110636128 13:77768576-77768598 GGAATCCCCCTCCCTCTACATGG 0: 1
1: 0
2: 1
3: 13
4: 144
1110636119_1110636129 25 Left 1110636119 13:77768529-77768551 CCTCTATAAAACCAACCGCATCC 0: 1
1: 3
2: 5
3: 8
4: 66
Right 1110636129 13:77768577-77768599 GAATCCCCCTCCCTCTACATGGG 0: 1
1: 0
2: 2
3: 12
4: 118
1110636119_1110636121 -10 Left 1110636119 13:77768529-77768551 CCTCTATAAAACCAACCGCATCC 0: 1
1: 3
2: 5
3: 8
4: 66
Right 1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 31
1110636119_1110636130 26 Left 1110636119 13:77768529-77768551 CCTCTATAAAACCAACCGCATCC 0: 1
1: 3
2: 5
3: 8
4: 66
Right 1110636130 13:77768578-77768600 AATCCCCCTCCCTCTACATGGGG 0: 1
1: 0
2: 2
3: 28
4: 233
1110636119_1110636126 3 Left 1110636119 13:77768529-77768551 CCTCTATAAAACCAACCGCATCC 0: 1
1: 3
2: 5
3: 8
4: 66
Right 1110636126 13:77768555-77768577 TGCTAACAGGGAGATCCATTCGG 0: 1
1: 0
2: 3
3: 10
4: 96
1110636119_1110636122 -9 Left 1110636119 13:77768529-77768551 CCTCTATAAAACCAACCGCATCC 0: 1
1: 3
2: 5
3: 8
4: 66
Right 1110636122 13:77768543-77768565 ACCGCATCCCGCTGCTAACAGGG 0: 1
1: 0
2: 0
3: 7
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110636119 Original CRISPR GGATGCGGTTGGTTTTATAG AGG (reversed) Intergenic
912878986 1:113390491-113390513 GGTTGCGGCTGGTTTGAAAGCGG + Intergenic
913384034 1:118240059-118240081 GAGTGCTGATGGTTTTATAGGGG + Intergenic
916266155 1:162891676-162891698 AGATGCGGTTGGTTTTATAGAGG + Intergenic
917292523 1:173485875-173485897 GGATTGGGTTTGTTTTCTAGTGG - Intronic
919472570 1:197997540-197997562 GGATGAGGTAGGTTTTAAAGGGG + Intergenic
922887439 1:229031015-229031037 GGATGCAGTTGATTATATAGAGG - Intergenic
1065006797 10:21387731-21387753 AGATGCGGGTGGTTTTATAGAGG - Intergenic
1068423073 10:56821603-56821625 GGATACAGTTAGTTTTATAGAGG - Intergenic
1074623250 10:115149032-115149054 GGCTGTGGTTGGTTTTATAGAGG + Intronic
1079471700 11:20784543-20784565 CGATGGGGCTGGTATTATAGAGG + Intronic
1082934483 11:58642157-58642179 GGTTCTGGTCGGTTTTATAGAGG - Intronic
1082974005 11:59054368-59054390 AGTTGTGGTTGGTTTTATAGAGG - Intergenic
1082978413 11:59098156-59098178 AGTTGTGGTTGGTTTTATAGAGG - Intergenic
1088189225 11:107208859-107208881 GGATTCTGTTGTTTTTAAAGTGG + Intergenic
1090324548 11:125873802-125873824 GGAAGCGGCTGGTTTTATAGAGG - Intergenic
1090494369 11:127195629-127195651 GGAAGGGGTTGGTTTTAGAAGGG - Intergenic
1095495418 12:42779166-42779188 GGAAGCTGTTTGTTTTCTAGTGG + Intergenic
1096628950 12:52913132-52913154 GGCTGTGGTTGCTTTTATGGTGG - Intronic
1110636119 13:77768529-77768551 GGATGCGGTTGGTTTTATAGAGG - Intergenic
1112771725 13:102800250-102800272 GGACGCTGTTGGTGTTAAAGGGG - Intronic
1117754935 14:58964919-58964941 GGGTGTGGTTGATTTTATAGAGG - Intergenic
1125626396 15:41112871-41112893 GGATGCAGTGGATTTTAGAGTGG - Intronic
1132248114 15:100313091-100313113 GGAAGCTATTGGTTTTGTAGAGG - Intronic
1134438702 16:14284623-14284645 TGATGCGGTAGGGTATATAGGGG - Intergenic
1138236185 16:55385053-55385075 GCATGGGGGTGTTTTTATAGAGG + Intergenic
1141126499 16:81404439-81404461 GGATGGGGTGGGGTTTACAGTGG - Intergenic
1148642367 17:49197646-49197668 GGAGGAGGTTGGTTTTAGGGAGG + Intergenic
1149526334 17:57358943-57358965 CTTTGCGATTGGTTTTATAGAGG + Intronic
1158086074 18:53653272-53653294 TGAAACTGTTGGTTTTATAGAGG + Intergenic
1158303556 18:56079640-56079662 GGATGAGGTTGACTTTATATGGG - Intergenic
1160488980 18:79320747-79320769 GGATGCTGTGGGTTTTACACTGG + Intronic
1160489000 18:79320849-79320871 GGATGCTGTGGGTTTTATACTGG + Intronic
1160489011 18:79320900-79320922 GGATGCTGTGGGTTTTATGCGGG + Intronic
1160972568 19:1776007-1776029 GGGTGGGGTTGGTTTTGGAGAGG - Exonic
1163050832 19:14682503-14682525 GGATGCACATGGTTTTTTAGGGG + Intronic
1163070627 19:14837675-14837697 GGATTCGGTTGGTTTTATAGAGG - Intergenic
1165840792 19:38788247-38788269 GGATGAGGTGGGTTTTAGGGTGG - Intergenic
928784259 2:34863134-34863156 AGCTGTGGTTGTTTTTATAGAGG + Intergenic
931254383 2:60557001-60557023 TGATGCAGGTGGTTTTGTAGAGG + Intergenic
933071996 2:77870757-77870779 GGATGGGGTTGGAGTTGTAGGGG + Intergenic
933273050 2:80254279-80254301 GCATGTGGTAGGTGTTATAGGGG - Intronic
1181718366 22:24752516-24752538 GGATGCAGTTGGTTTTATAGAGG - Intronic
1181810961 22:25403848-25403870 GGAAGCTGTTTGTTTTAAAGGGG - Intronic
1182911261 22:33986595-33986617 AGAGGCGGTGGGTTTTAAAGAGG + Intergenic
954177960 3:48859201-48859223 GGCTGTGGTTGGTGTTATACAGG - Exonic
955006630 3:54974718-54974740 GGATGAGGTTGTTTTTAAAAAGG - Intronic
957911466 3:86624486-86624508 AGATTTGGTTGATTTTATAGAGG - Intergenic
959053548 3:101547447-101547469 GGAGGAGGTTAGTTTTAGAGAGG - Intergenic
967228032 3:187312001-187312023 GGAGGGGGTGGGGTTTATAGAGG + Intergenic
976986617 4:91308387-91308409 GGAAGCGTTTGGTGTTATAATGG + Intronic
977225358 4:94387016-94387038 GGATGGGGTTTGTCTCATAGCGG + Intergenic
977742359 4:100502087-100502109 GGATGCAGTGGGCTTAATAGAGG + Intronic
981550678 4:145937993-145938015 GGATGCCGGGGGTTTTATCGGGG - Intronic
981782080 4:148442237-148442259 GGATGTGGTTGGATTTAGGGGGG - Exonic
985196731 4:187438232-187438254 GGATGGGGTTGGTTTTAGGGAGG + Intergenic
988662679 5:33290423-33290445 GCATGTGGCTGGTTTTATAAAGG - Intergenic
989224230 5:39007058-39007080 GTATATGGTTGGTTTTTTAGAGG - Intronic
989908989 5:49599970-49599992 GGATGCTTTAGGATTTATAGTGG - Intergenic
997069298 5:130601000-130601022 GGATGTGGTTTATTTTATGGCGG - Intergenic
997151259 5:131498427-131498449 AGATAAGGTTGGTTTTATAAGGG - Exonic
998476761 5:142428599-142428621 GGATTCCGTGGGTTTGATAGTGG - Intergenic
1007953733 6:45897312-45897334 GGCTGTGGTTGGTTTCAAAGTGG - Intergenic
1010397609 6:75409888-75409910 GGTTGGGGATGGTATTATAGGGG - Intronic
1019574186 7:1728329-1728351 GAATGCGGTTGGTCTGAAAGAGG - Intronic
1021900049 7:25276197-25276219 GGAAGCTGTTGGTGTTATAAGGG + Intergenic
1022811656 7:33874622-33874644 GGAGGCGGTTGCTATTATATGGG - Intergenic
1024770179 7:52713208-52713230 GTATGCAGTTGGTTTTATAGAGG - Intergenic
1029333877 7:99883541-99883563 AGATGCAGTTGACTTTATAGAGG + Intronic
1030684529 7:112471038-112471060 GGATGCTGATGACTTTATAGAGG + Intronic
1052677959 9:31651116-31651138 AGATGCAGTTGATTTTCTAGAGG + Intergenic
1052961827 9:34304670-34304692 TGATTGGGTTGGTTTTACAGTGG + Intronic
1053025371 9:34724610-34724632 GGATGCGTCTGGCTTTCTAGAGG + Exonic
1053036900 9:34833672-34833694 GGATGCGTCTGGCTTTCTAGAGG + Intergenic
1056880451 9:90386888-90386910 GGCTGCAGTTGGTTTCATGGTGG + Intergenic
1056964342 9:91153433-91153455 GGAGGGGGTTAGTTTTATGGAGG + Intergenic
1060330992 9:122670164-122670186 AGATGTGGTCGATTTTATAGAGG - Intergenic
1061554492 9:131358624-131358646 GGATGTGGTTGGTTTTACAGAGG + Intergenic
1062409759 9:136417424-136417446 GGATGCGGTTCTTTCTCTAGGGG + Intronic
1195222873 X:102763111-102763133 GGAAGCTGCTGGTTTTATTGTGG + Intergenic
1197273304 X:124449358-124449380 GGATGAGGTAGATTTTATGGTGG + Intronic
1197337579 X:125226594-125226616 GGAGGGGGTTAGTTTTAGAGAGG + Intergenic
1199015671 X:142811897-142811919 GAATGATGTTGGTTTTTTAGTGG - Intergenic
1201690670 Y:16761272-16761294 AGATGCTGTTGATATTATAGAGG - Intergenic