ID: 1110636121

View in Genome Browser
Species Human (GRCh38)
Location 13:77768542-77768564
Sequence AACCGCATCCCGCTGCTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 31}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110636113_1110636121 23 Left 1110636113 13:77768496-77768518 CCTTATGTAAATCAGATACCGCC 0: 4
1: 90
2: 339
3: 469
4: 401
Right 1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 31
1110636115_1110636121 2 Left 1110636115 13:77768517-77768539 CCTCCTCGAGCCCCTCTATAAAA 0: 1
1: 5
2: 14
3: 201
4: 391
Right 1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 31
1110636117_1110636121 -8 Left 1110636117 13:77768527-77768549 CCCCTCTATAAAACCAACCGCAT 0: 1
1: 2
2: 2
3: 14
4: 90
Right 1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 31
1110636111_1110636121 30 Left 1110636111 13:77768489-77768511 CCCTGGGCCTTATGTAAATCAGA 0: 2
1: 12
2: 46
3: 168
4: 284
Right 1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 31
1110636118_1110636121 -9 Left 1110636118 13:77768528-77768550 CCCTCTATAAAACCAACCGCATC 0: 1
1: 2
2: 4
3: 17
4: 100
Right 1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 31
1110636112_1110636121 29 Left 1110636112 13:77768490-77768512 CCTGGGCCTTATGTAAATCAGAT 0: 1
1: 3
2: 10
3: 64
4: 287
Right 1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 31
1110636116_1110636121 -1 Left 1110636116 13:77768520-77768542 CCTCGAGCCCCTCTATAAAACCA 0: 1
1: 2
2: 9
3: 25
4: 249
Right 1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 31
1110636119_1110636121 -10 Left 1110636119 13:77768529-77768551 CCTCTATAAAACCAACCGCATCC 0: 1
1: 3
2: 5
3: 8
4: 66
Right 1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 31
1110636114_1110636121 5 Left 1110636114 13:77768514-77768536 CCGCCTCCTCGAGCCCCTCTATA 0: 1
1: 6
2: 8
3: 138
4: 402
Right 1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG 0: 1
1: 0
2: 0
3: 2
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110636121 Original CRISPR AACCGCATCCCGCTGCTAAC AGG Intergenic
901937206 1:12635161-12635183 GACCGCATCTCGCTGCAAACTGG + Intergenic
924732911 1:246728485-246728507 AAATGTATCCCCCTGCTAACTGG + Intronic
1073219498 10:101858318-101858340 AGCTCCATCCTGCTGCTAACTGG - Intronic
1083311113 11:61784245-61784267 AACCTCATTTCTCTGCTAACTGG + Intronic
1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG + Intergenic
1125177469 15:36841331-36841353 CACTGCTTCCGGCTGCTAACAGG + Intergenic
1128772206 15:70290981-70291003 AACAGCATTCCGCTGCTTATGGG - Intergenic
1133218047 16:4305376-4305398 CACCGCACCCGGCTGCTAAAGGG + Intergenic
1137842243 16:51651277-51651299 AACCGCAGCCTCCTGCTAATGGG + Intergenic
1141718961 16:85744540-85744562 CACCGCATCTGGCTGCTGACAGG - Intronic
1144683491 17:17210924-17210946 CACCGCACCCAGCTGCCAACTGG - Intronic
1149665591 17:58362933-58362955 AACCTCATCCAGCGGCTCACTGG - Intronic
1158793474 18:60811757-60811779 AACCAAATCCCACTGCTGACTGG - Intergenic
1162675260 19:12294170-12294192 AACCGCATTCTGCTGCTGAGTGG - Intronic
1163786253 19:19276459-19276481 TCTTGCATCCCGCTGCTAACAGG + Intronic
1165881183 19:39045125-39045147 CACCGCATCCTGCTGCCAGCTGG - Intergenic
927442833 2:23131416-23131438 AAGCGCATCCCGGTGCTGGCTGG - Intergenic
932242539 2:70168574-70168596 CACCGCACCCGGCTGCTAATAGG + Intronic
932693262 2:73931579-73931601 AACAGCCTCCCACTGCCAACAGG - Intronic
933349934 2:81140745-81140767 CACCGCATCCAGCCACTAACAGG - Intergenic
1176861667 21:14014467-14014489 AACCGCATGACGAGGCTAACAGG - Intergenic
1179394437 21:41025009-41025031 AACAGCAGCCCGGTGCTTACAGG + Intergenic
955050838 3:55409385-55409407 CACCTCATCCCTCGGCTAACAGG - Intergenic
970536392 4:17034159-17034181 AACCGCCTTCCGCTGCTTTCTGG + Intergenic
978315593 4:107433055-107433077 AACCGCATCCTCCTCTTAACAGG + Intergenic
988680084 5:33476436-33476458 AGCCGCATCTCTCTGCTGACTGG + Intergenic
1001308960 5:170597043-170597065 AAGCTCATGCAGCTGCTAACAGG + Intronic
1004811778 6:19270752-19270774 AACCGGCTCCCTCTGCTCACGGG + Intergenic
1005549333 6:26898029-26898051 AGCCTCATCCCGCTGCCAGCTGG + Intergenic
1005549684 6:26899666-26899688 AGCCTCATCCCGCTGCCAGCTGG + Intergenic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1014594571 6:123318426-123318448 AACCTCATTCAGCTGCTAAGTGG + Intronic
1026092133 7:67309067-67309089 AACCTCATCTCCCTGCTCACTGG + Intergenic
1033707298 7:143902073-143902095 AACCGCCTCCCGCTCCTAGCAGG - Exonic