ID: 1110639770

View in Genome Browser
Species Human (GRCh38)
Location 13:77809354-77809376
Sequence CTCAATGAACATTCTTATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110639770_1110639780 28 Left 1110639770 13:77809354-77809376 CCCCCATAAGAATGTTCATTGAG No data
Right 1110639780 13:77809405-77809427 TCTGTCCTATGTTCAGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110639770 Original CRISPR CTCAATGAACATTCTTATGG GGG (reversed) Intergenic
No off target data available for this crispr