ID: 1110642451

View in Genome Browser
Species Human (GRCh38)
Location 13:77841358-77841380
Sequence GAGTGAGAACATGCAGTGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52076
Summary {0: 4435, 1: 11380, 2: 17706, 3: 10546, 4: 8009}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110642451_1110642457 17 Left 1110642451 13:77841358-77841380 CCAAACACTGCATGTTCTCACTC 0: 4435
1: 11380
2: 17706
3: 10546
4: 8009
Right 1110642457 13:77841398-77841420 AGTGAGAACACGTGGGCATAGGG No data
1110642451_1110642458 21 Left 1110642451 13:77841358-77841380 CCAAACACTGCATGTTCTCACTC 0: 4435
1: 11380
2: 17706
3: 10546
4: 8009
Right 1110642458 13:77841402-77841424 AGAACACGTGGGCATAGGGAAGG No data
1110642451_1110642456 16 Left 1110642451 13:77841358-77841380 CCAAACACTGCATGTTCTCACTC 0: 4435
1: 11380
2: 17706
3: 10546
4: 8009
Right 1110642456 13:77841397-77841419 CAGTGAGAACACGTGGGCATAGG No data
1110642451_1110642459 22 Left 1110642451 13:77841358-77841380 CCAAACACTGCATGTTCTCACTC 0: 4435
1: 11380
2: 17706
3: 10546
4: 8009
Right 1110642459 13:77841403-77841425 GAACACGTGGGCATAGGGAAGGG No data
1110642451_1110642454 9 Left 1110642451 13:77841358-77841380 CCAAACACTGCATGTTCTCACTC 0: 4435
1: 11380
2: 17706
3: 10546
4: 8009
Right 1110642454 13:77841390-77841412 AGACGAACAGTGAGAACACGTGG No data
1110642451_1110642455 10 Left 1110642451 13:77841358-77841380 CCAAACACTGCATGTTCTCACTC 0: 4435
1: 11380
2: 17706
3: 10546
4: 8009
Right 1110642455 13:77841391-77841413 GACGAACAGTGAGAACACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110642451 Original CRISPR GAGTGAGAACATGCAGTGTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr