ID: 1110642456

View in Genome Browser
Species Human (GRCh38)
Location 13:77841397-77841419
Sequence CAGTGAGAACACGTGGGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110642451_1110642456 16 Left 1110642451 13:77841358-77841380 CCAAACACTGCATGTTCTCACTC 0: 4435
1: 11380
2: 17706
3: 10546
4: 8009
Right 1110642456 13:77841397-77841419 CAGTGAGAACACGTGGGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110642456 Original CRISPR CAGTGAGAACACGTGGGCAT AGG Intergenic
No off target data available for this crispr