ID: 1110642915

View in Genome Browser
Species Human (GRCh38)
Location 13:77847091-77847113
Sequence CAAGATCAGCAATTTCATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110642914_1110642915 1 Left 1110642914 13:77847067-77847089 CCACTTTTGAGATCACAAATGGC No data
Right 1110642915 13:77847091-77847113 CAAGATCAGCAATTTCATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110642915 Original CRISPR CAAGATCAGCAATTTCATAT AGG Intergenic
No off target data available for this crispr