ID: 1110645133

View in Genome Browser
Species Human (GRCh38)
Location 13:77873849-77873871
Sequence CTGCTGTGCTTGAGTAGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110645132_1110645133 -8 Left 1110645132 13:77873834-77873856 CCGGAGAATCAATTTCTGCTGTG No data
Right 1110645133 13:77873849-77873871 CTGCTGTGCTTGAGTAGAAGTGG No data
1110645129_1110645133 20 Left 1110645129 13:77873806-77873828 CCAAATTTAAACTTTTAGTTGTG No data
Right 1110645133 13:77873849-77873871 CTGCTGTGCTTGAGTAGAAGTGG No data
1110645131_1110645133 -5 Left 1110645131 13:77873831-77873853 CCACCGGAGAATCAATTTCTGCT No data
Right 1110645133 13:77873849-77873871 CTGCTGTGCTTGAGTAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110645133 Original CRISPR CTGCTGTGCTTGAGTAGAAG TGG Intergenic
No off target data available for this crispr