ID: 1110660299

View in Genome Browser
Species Human (GRCh38)
Location 13:78053070-78053092
Sequence CTTAGGCACTGCCATGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110660296_1110660299 -2 Left 1110660296 13:78053049-78053071 CCTTGAGTGTGTGTGCTATATCT No data
Right 1110660299 13:78053070-78053092 CTTAGGCACTGCCATGGCCCTGG No data
1110660291_1110660299 28 Left 1110660291 13:78053019-78053041 CCTTAAGGCAATGCCACTGACTG No data
Right 1110660299 13:78053070-78053092 CTTAGGCACTGCCATGGCCCTGG No data
1110660295_1110660299 15 Left 1110660295 13:78053032-78053054 CCACTGACTGGGGCTTTCCTTGA No data
Right 1110660299 13:78053070-78053092 CTTAGGCACTGCCATGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110660299 Original CRISPR CTTAGGCACTGCCATGGCCC TGG Intergenic
No off target data available for this crispr