ID: 1110660990

View in Genome Browser
Species Human (GRCh38)
Location 13:78059440-78059462
Sequence CGGCAAACAGCAGTGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110660990_1110660998 24 Left 1110660990 13:78059440-78059462 CCATGCACCACTGCTGTTTGCCG No data
Right 1110660998 13:78059487-78059509 CCACCCCTCCCTATCCAGCAGGG No data
1110660990_1110660996 23 Left 1110660990 13:78059440-78059462 CCATGCACCACTGCTGTTTGCCG No data
Right 1110660996 13:78059486-78059508 TCCACCCCTCCCTATCCAGCAGG No data
1110660990_1110661002 30 Left 1110660990 13:78059440-78059462 CCATGCACCACTGCTGTTTGCCG No data
Right 1110661002 13:78059493-78059515 CTCCCTATCCAGCAGGGTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110660990 Original CRISPR CGGCAAACAGCAGTGGTGCA TGG (reversed) Intergenic
No off target data available for this crispr