ID: 1110660996

View in Genome Browser
Species Human (GRCh38)
Location 13:78059486-78059508
Sequence TCCACCCCTCCCTATCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110660992_1110660996 3 Left 1110660992 13:78059460-78059482 CCGCCATCGCAGACCCGCTGCTG No data
Right 1110660996 13:78059486-78059508 TCCACCCCTCCCTATCCAGCAGG No data
1110660990_1110660996 23 Left 1110660990 13:78059440-78059462 CCATGCACCACTGCTGTTTGCCG No data
Right 1110660996 13:78059486-78059508 TCCACCCCTCCCTATCCAGCAGG No data
1110660993_1110660996 0 Left 1110660993 13:78059463-78059485 CCATCGCAGACCCGCTGCTGACT No data
Right 1110660996 13:78059486-78059508 TCCACCCCTCCCTATCCAGCAGG No data
1110660991_1110660996 16 Left 1110660991 13:78059447-78059469 CCACTGCTGTTTGCCGCCATCGC 0: 19
1: 64
2: 97
3: 134
4: 252
Right 1110660996 13:78059486-78059508 TCCACCCCTCCCTATCCAGCAGG No data
1110660994_1110660996 -10 Left 1110660994 13:78059473-78059495 CCCGCTGCTGACTTCCACCCCTC No data
Right 1110660996 13:78059486-78059508 TCCACCCCTCCCTATCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110660996 Original CRISPR TCCACCCCTCCCTATCCAGC AGG Intergenic
No off target data available for this crispr