ID: 1110661068

View in Genome Browser
Species Human (GRCh38)
Location 13:78059880-78059902
Sequence TGAGCTTAAAAAACATATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110661068_1110661071 18 Left 1110661068 13:78059880-78059902 CCCAAATATGTTTTTTAAGCTCA No data
Right 1110661071 13:78059921-78059943 CAAGAATACCAATTATTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110661068 Original CRISPR TGAGCTTAAAAAACATATTT GGG (reversed) Intergenic
No off target data available for this crispr