ID: 1110661069

View in Genome Browser
Species Human (GRCh38)
Location 13:78059881-78059903
Sequence ATGAGCTTAAAAAACATATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110661069_1110661071 17 Left 1110661069 13:78059881-78059903 CCAAATATGTTTTTTAAGCTCAT No data
Right 1110661071 13:78059921-78059943 CAAGAATACCAATTATTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110661069 Original CRISPR ATGAGCTTAAAAAACATATT TGG (reversed) Intergenic
No off target data available for this crispr