ID: 1110661071

View in Genome Browser
Species Human (GRCh38)
Location 13:78059921-78059943
Sequence CAAGAATACCAATTATTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110661066_1110661071 20 Left 1110661066 13:78059878-78059900 CCCCCAAATATGTTTTTTAAGCT No data
Right 1110661071 13:78059921-78059943 CAAGAATACCAATTATTTTTAGG No data
1110661067_1110661071 19 Left 1110661067 13:78059879-78059901 CCCCAAATATGTTTTTTAAGCTC No data
Right 1110661071 13:78059921-78059943 CAAGAATACCAATTATTTTTAGG No data
1110661065_1110661071 28 Left 1110661065 13:78059870-78059892 CCATTTTTCCCCCAAATATGTTT No data
Right 1110661071 13:78059921-78059943 CAAGAATACCAATTATTTTTAGG No data
1110661069_1110661071 17 Left 1110661069 13:78059881-78059903 CCAAATATGTTTTTTAAGCTCAT No data
Right 1110661071 13:78059921-78059943 CAAGAATACCAATTATTTTTAGG No data
1110661068_1110661071 18 Left 1110661068 13:78059880-78059902 CCCAAATATGTTTTTTAAGCTCA No data
Right 1110661071 13:78059921-78059943 CAAGAATACCAATTATTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110661071 Original CRISPR CAAGAATACCAATTATTTTT AGG Intergenic
No off target data available for this crispr