ID: 1110661171

View in Genome Browser
Species Human (GRCh38)
Location 13:78060794-78060816
Sequence ATACCACAGCTGATGTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110661171_1110661177 0 Left 1110661171 13:78060794-78060816 CCAGAGAACATCAGCTGTGGTAT No data
Right 1110661177 13:78060817-78060839 CATGGGGAGGAATCAGCAGTGGG No data
1110661171_1110661179 4 Left 1110661171 13:78060794-78060816 CCAGAGAACATCAGCTGTGGTAT No data
Right 1110661179 13:78060821-78060843 GGGAGGAATCAGCAGTGGGTGGG No data
1110661171_1110661178 3 Left 1110661171 13:78060794-78060816 CCAGAGAACATCAGCTGTGGTAT No data
Right 1110661178 13:78060820-78060842 GGGGAGGAATCAGCAGTGGGTGG No data
1110661171_1110661180 5 Left 1110661171 13:78060794-78060816 CCAGAGAACATCAGCTGTGGTAT No data
Right 1110661180 13:78060822-78060844 GGAGGAATCAGCAGTGGGTGGGG No data
1110661171_1110661176 -1 Left 1110661171 13:78060794-78060816 CCAGAGAACATCAGCTGTGGTAT No data
Right 1110661176 13:78060816-78060838 TCATGGGGAGGAATCAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110661171 Original CRISPR ATACCACAGCTGATGTTCTC TGG (reversed) Intergenic
No off target data available for this crispr