ID: 1110664692

View in Genome Browser
Species Human (GRCh38)
Location 13:78102780-78102802
Sequence GATCTTGGTCATGAGGGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110664687_1110664692 9 Left 1110664687 13:78102748-78102770 CCAGCTCTGTAGTAGCTTTTTAA No data
Right 1110664692 13:78102780-78102802 GATCTTGGTCATGAGGGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110664692 Original CRISPR GATCTTGGTCATGAGGGCTT AGG Intergenic
No off target data available for this crispr