ID: 1110664751

View in Genome Browser
Species Human (GRCh38)
Location 13:78103805-78103827
Sequence CTTTCTAACCTGGTGGTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110664751_1110664757 21 Left 1110664751 13:78103805-78103827 CCTACCACCACCAGGTTAGAAAG No data
Right 1110664757 13:78103849-78103871 GAGGATAAGAGAGTTCTTCCAGG No data
1110664751_1110664756 2 Left 1110664751 13:78103805-78103827 CCTACCACCACCAGGTTAGAAAG No data
Right 1110664756 13:78103830-78103852 GCATGCAAGCTGAAGCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110664751 Original CRISPR CTTTCTAACCTGGTGGTGGT AGG (reversed) Intergenic
No off target data available for this crispr