ID: 1110670389

View in Genome Browser
Species Human (GRCh38)
Location 13:78170001-78170023
Sequence GAGAGCACCTGCACGCACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110670389_1110670392 3 Left 1110670389 13:78170001-78170023 CCACTGTGCGTGCAGGTGCTCTC No data
Right 1110670392 13:78170027-78170049 CCCACTGTATACTGTCTTGTGGG No data
1110670389_1110670394 9 Left 1110670389 13:78170001-78170023 CCACTGTGCGTGCAGGTGCTCTC No data
Right 1110670394 13:78170033-78170055 GTATACTGTCTTGTGGGAATTGG No data
1110670389_1110670390 2 Left 1110670389 13:78170001-78170023 CCACTGTGCGTGCAGGTGCTCTC No data
Right 1110670390 13:78170026-78170048 ACCCACTGTATACTGTCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110670389 Original CRISPR GAGAGCACCTGCACGCACAG TGG (reversed) Intergenic
No off target data available for this crispr