ID: 1110675042

View in Genome Browser
Species Human (GRCh38)
Location 13:78232406-78232428
Sequence TATTCTATGGTGAAGGTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110675042_1110675045 -5 Left 1110675042 13:78232406-78232428 CCTACAACCTTCACCATAGAATA No data
Right 1110675045 13:78232424-78232446 GAATAGTGTTTATGATAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110675042 Original CRISPR TATTCTATGGTGAAGGTTGT AGG (reversed) Intergenic
No off target data available for this crispr