ID: 1110675045

View in Genome Browser
Species Human (GRCh38)
Location 13:78232424-78232446
Sequence GAATAGTGTTTATGATAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110675040_1110675045 2 Left 1110675040 13:78232399-78232421 CCTATACCCTACAACCTTCACCA No data
Right 1110675045 13:78232424-78232446 GAATAGTGTTTATGATAATATGG No data
1110675042_1110675045 -5 Left 1110675042 13:78232406-78232428 CCTACAACCTTCACCATAGAATA No data
Right 1110675045 13:78232424-78232446 GAATAGTGTTTATGATAATATGG No data
1110675041_1110675045 -4 Left 1110675041 13:78232405-78232427 CCCTACAACCTTCACCATAGAAT No data
Right 1110675045 13:78232424-78232446 GAATAGTGTTTATGATAATATGG No data
1110675039_1110675045 7 Left 1110675039 13:78232394-78232416 CCTTTCCTATACCCTACAACCTT No data
Right 1110675045 13:78232424-78232446 GAATAGTGTTTATGATAATATGG No data
1110675038_1110675045 24 Left 1110675038 13:78232377-78232399 CCTTTTCATTCTTTTAACCTTTC No data
Right 1110675045 13:78232424-78232446 GAATAGTGTTTATGATAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110675045 Original CRISPR GAATAGTGTTTATGATAATA TGG Intergenic
No off target data available for this crispr