ID: 1110686738

View in Genome Browser
Species Human (GRCh38)
Location 13:78384462-78384484
Sequence TGGTCCACATTTTAGAGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110686736_1110686738 -2 Left 1110686736 13:78384441-78384463 CCTGCAAGGATGATTCTATTATG No data
Right 1110686738 13:78384462-78384484 TGGTCCACATTTTAGAGCTAAGG No data
1110686735_1110686738 -1 Left 1110686735 13:78384440-78384462 CCCTGCAAGGATGATTCTATTAT No data
Right 1110686738 13:78384462-78384484 TGGTCCACATTTTAGAGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110686738 Original CRISPR TGGTCCACATTTTAGAGCTA AGG Intergenic
No off target data available for this crispr