ID: 1110695620

View in Genome Browser
Species Human (GRCh38)
Location 13:78484733-78484755
Sequence CATGAGAGGGACCCGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110695609_1110695620 19 Left 1110695609 13:78484691-78484713 CCCAACTCAAATCTCATCTTGAA 0: 11
1: 673
2: 9286
3: 12538
4: 10307
Right 1110695620 13:78484733-78484755 CATGAGAGGGACCCGGTGGAGGG No data
1110695610_1110695620 18 Left 1110695610 13:78484692-78484714 CCAACTCAAATCTCATCTTGAAT 0: 549
1: 8481
2: 11478
3: 10298
4: 7527
Right 1110695620 13:78484733-78484755 CATGAGAGGGACCCGGTGGAGGG No data
1110695612_1110695620 -5 Left 1110695612 13:78484715-78484737 CCTATAATTCCCAGGTGTCATGA No data
Right 1110695620 13:78484733-78484755 CATGAGAGGGACCCGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110695620 Original CRISPR CATGAGAGGGACCCGGTGGA GGG Intergenic
No off target data available for this crispr