ID: 1110698583

View in Genome Browser
Species Human (GRCh38)
Location 13:78520419-78520441
Sequence GCATTTAGACTCTTGGCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110698583_1110698587 2 Left 1110698583 13:78520419-78520441 CCATGAGCCAAGAGTCTAAATGC No data
Right 1110698587 13:78520444-78520466 CCTAGTTAGGTCCTTTGATCAGG No data
1110698583_1110698588 3 Left 1110698583 13:78520419-78520441 CCATGAGCCAAGAGTCTAAATGC No data
Right 1110698588 13:78520445-78520467 CTAGTTAGGTCCTTTGATCAGGG No data
1110698583_1110698590 25 Left 1110698583 13:78520419-78520441 CCATGAGCCAAGAGTCTAAATGC No data
Right 1110698590 13:78520467-78520489 GTCTCACAAGACTTCAGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110698583 Original CRISPR GCATTTAGACTCTTGGCTCA TGG (reversed) Intergenic
No off target data available for this crispr