ID: 1110698835

View in Genome Browser
Species Human (GRCh38)
Location 13:78523433-78523455
Sequence GAATATTCACTGATGGACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110698835_1110698840 20 Left 1110698835 13:78523433-78523455 CCTTGGTCCATCAGTGAATATTC No data
Right 1110698840 13:78523476-78523498 GGTCAAATCTCTCTTCCTCCAGG No data
1110698835_1110698838 -1 Left 1110698835 13:78523433-78523455 CCTTGGTCCATCAGTGAATATTC No data
Right 1110698838 13:78523455-78523477 CTCTTTATTCGCAAAGGCCTAGG No data
1110698835_1110698837 -7 Left 1110698835 13:78523433-78523455 CCTTGGTCCATCAGTGAATATTC No data
Right 1110698837 13:78523449-78523471 AATATTCTCTTTATTCGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110698835 Original CRISPR GAATATTCACTGATGGACCA AGG (reversed) Intergenic
No off target data available for this crispr