ID: 1110698835 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:78523433-78523455 |
| Sequence | GAATATTCACTGATGGACCA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1110698835_1110698840 | 20 | Left | 1110698835 | 13:78523433-78523455 | CCTTGGTCCATCAGTGAATATTC | No data | ||
| Right | 1110698840 | 13:78523476-78523498 | GGTCAAATCTCTCTTCCTCCAGG | No data | ||||
| 1110698835_1110698838 | -1 | Left | 1110698835 | 13:78523433-78523455 | CCTTGGTCCATCAGTGAATATTC | No data | ||
| Right | 1110698838 | 13:78523455-78523477 | CTCTTTATTCGCAAAGGCCTAGG | No data | ||||
| 1110698835_1110698837 | -7 | Left | 1110698835 | 13:78523433-78523455 | CCTTGGTCCATCAGTGAATATTC | No data | ||
| Right | 1110698837 | 13:78523449-78523471 | AATATTCTCTTTATTCGCAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1110698835 | Original CRISPR | GAATATTCACTGATGGACCA AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||