ID: 1110700387

View in Genome Browser
Species Human (GRCh38)
Location 13:78540626-78540648
Sequence CTCTGCAAGAAGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110700387_1110700395 15 Left 1110700387 13:78540626-78540648 CCATCCTCCTTCTTCTTGCAGAG No data
Right 1110700395 13:78540664-78540686 AGAATCACCCCAGCTTGTCTAGG No data
1110700387_1110700394 -10 Left 1110700387 13:78540626-78540648 CCATCCTCCTTCTTCTTGCAGAG No data
Right 1110700394 13:78540639-78540661 TCTTGCAGAGGGGAGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110700387 Original CRISPR CTCTGCAAGAAGAAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr