ID: 1110705375

View in Genome Browser
Species Human (GRCh38)
Location 13:78597728-78597750
Sequence CAGGAAATCCAGGCGGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110705375_1110705381 -3 Left 1110705375 13:78597728-78597750 CCCGCCGCCGCCTGGATTTCCTG 0: 1
1: 0
2: 0
3: 13
4: 165
Right 1110705381 13:78597748-78597770 CTGAGAAGCTGAAATGCAAACGG 0: 1
1: 0
2: 4
3: 48
4: 455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110705375 Original CRISPR CAGGAAATCCAGGCGGCGGC GGG (reversed) Intergenic
900338197 1:2175247-2175269 CAGAAAATCCAGTCTGTGGCCGG - Exonic
900360982 1:2288981-2289003 CGGGAAAACCAGGCGGCACCGGG - Intronic
900565418 1:3329572-3329594 CAGGAAAACCAGGCAGAGGAAGG + Intronic
903847562 1:26287545-26287567 CAGGACAAGCAGGCTGCGGCAGG + Intronic
904842744 1:33383918-33383940 TATGAAATCCAGGTGTCGGCAGG - Intronic
905011712 1:34751569-34751591 CTGGAAATCCAGGAGGGAGCTGG - Intronic
905653060 1:39669246-39669268 CAGGAAGTCCAGGTGGGGGTGGG - Intronic
907240510 1:53078502-53078524 CAGGTACTCCAGGCTGCGGATGG - Exonic
908770206 1:67589146-67589168 CAGGAATTCAAGGCTGCGGTGGG + Intergenic
910458823 1:87426487-87426509 CAGGAAATCCAGCCGCCTGTCGG + Intergenic
912384807 1:109265977-109265999 CAGGAAAGCCAGGAAGGGGCTGG + Intronic
920106595 1:203557629-203557651 CTGGAAATTCAGGCAGAGGCCGG + Intergenic
921275142 1:213511699-213511721 AAGGAAATCCAGGCATGGGCAGG - Intergenic
921596510 1:217059717-217059739 CAGGAAATACAGGGGGCAGAGGG + Intronic
924052340 1:240091998-240092020 CGGGAGAGTCAGGCGGCGGCGGG - Exonic
1065123967 10:22555069-22555091 CAGGACAGCCAGGCTGCGGGGGG - Intronic
1067088802 10:43256219-43256241 AAGGCAAGCCAGGCGGGGGCAGG + Intronic
1067390371 10:45857800-45857822 CAGGCAATCAAGGTGGTGGCTGG - Intergenic
1067872905 10:49978267-49978289 CAGGCAATCAAGGTGGTGGCTGG + Intergenic
1069694097 10:70374164-70374186 CAGGCACTCCAGGCAGTGGCAGG - Intronic
1070137546 10:73707986-73708008 CAGGCAATCAAGGTGGTGGCTGG - Intergenic
1072759723 10:98046503-98046525 CAGGAATTCCAGGCTGAGGGTGG + Intergenic
1077050815 11:565992-566014 CAGGGAAGCCAGGCAGCAGCAGG + Intergenic
1077474593 11:2780389-2780411 CAGGAAATCCAGCAGCCGCCCGG + Intronic
1077498865 11:2899930-2899952 CAGGGAACCCAGGAGGCGTCTGG + Intronic
1079117483 11:17649557-17649579 CAAGAAATCCAGGCAGCCTCTGG + Intergenic
1082055225 11:47809178-47809200 CAGGAAATCAAGGCTGCAGTGGG + Intronic
1083470389 11:62880494-62880516 TGGGAAAACCAGACGGCGGCCGG + Intronic
1083664113 11:64265433-64265455 CAGGCCATCCAGCAGGCGGCGGG - Exonic
1083738018 11:64692783-64692805 CAGAAAATCCAGGCGCAGGTTGG + Intronic
1083884852 11:65567897-65567919 CAGGAGATCCAGGCTGCAGTGGG - Intergenic
1087012848 11:93529794-93529816 AAGGAACTCCAGGCGGAGGCTGG - Intronic
1090073973 11:123567700-123567722 CAGGAAAGCCAGGCAGCAGGGGG + Intronic
1092834013 12:12471088-12471110 CAGGAAATGCAGGATGTGGCCGG - Intergenic
1093958761 12:25250787-25250809 CAGGCACTGAAGGCGGCGGCGGG - Exonic
1101036927 12:100716165-100716187 GAGGGCAGCCAGGCGGCGGCGGG - Intergenic
1101675424 12:106912680-106912702 CTGTAAATCCAGGAGGCAGCTGG - Intergenic
1101890599 12:108711294-108711316 CAGGAAATCAAGGCTGCAGTGGG + Intronic
1103011303 12:117460493-117460515 CTGGAAATCCGGGCTGCTGCTGG + Exonic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1104917471 12:132273353-132273375 CAGGAACCCCAGGCCGAGGCGGG - Intronic
1105817598 13:24051290-24051312 CAGGAAGTCCTGCCGGCTGCAGG - Intronic
1107528943 13:41263436-41263458 GAGGCAATACAGGAGGCGGCGGG + Intronic
1110705375 13:78597728-78597750 CAGGAAATCCAGGCGGCGGCGGG - Intergenic
1113957593 13:114107565-114107587 CCGGAACTCCAGGCTGCTGCGGG + Intronic
1115531889 14:34335403-34335425 CAGGAAGTCAAGGCTGTGGCAGG - Intronic
1117516435 14:56506749-56506771 CAGGAAATGTAGGCAGAGGCGGG + Intronic
1118687158 14:68302485-68302507 CATGGAATCCAGGCAGGGGCCGG + Intronic
1118943269 14:70358825-70358847 CATGAAATGCAGGCTGAGGCTGG - Intronic
1120190672 14:81436583-81436605 CAGCAGATCCCGGCGGCGCCCGG - Intergenic
1125094863 15:35839300-35839322 CAGGAAATCCAGGTACTGGCAGG - Intergenic
1127534648 15:59878836-59878858 CAGGAAATCCAAAGGGCTGCTGG - Intergenic
1130362013 15:83197940-83197962 CAGGAGAACCTGGGGGCGGCGGG + Intronic
1130370567 15:83283316-83283338 CGGCAAAGCCAGGCGGCGGCGGG + Intronic
1132291791 15:100708973-100708995 GAGGAAAACCAGGCAGGGGCTGG + Intergenic
1132559481 16:586905-586927 GAGGACATCCCGGCGGCTGCTGG + Intergenic
1132689456 16:1175986-1176008 CAGGACATCCTGGTGGCTGCTGG + Intronic
1133933308 16:10249718-10249740 CAGGACATGCAGGGGGCAGCTGG - Intergenic
1134244464 16:12529670-12529692 CAGCAAATGGGGGCGGCGGCGGG - Intronic
1135776051 16:25258090-25258112 CGGAGAATCTAGGCGGCGGCGGG + Intergenic
1136628666 16:31476886-31476908 CAGGAAGTCCCGGCGGCAGTAGG - Exonic
1136752433 16:32651171-32651193 CGGGAAAAACCGGCGGCGGCGGG + Intergenic
1138374573 16:56553890-56553912 AAGGAAATCGAGGCCGGGGCAGG + Intergenic
1138492753 16:57385929-57385951 CAGGAGATCCAGGAGGTGGAGGG - Intergenic
1138558514 16:57786689-57786711 CAGGAAACCCAGCCCTCGGCAGG + Intronic
1138605820 16:58088200-58088222 GAAGAAATGGAGGCGGCGGCGGG + Intergenic
1141099340 16:81185592-81185614 CAGCAGAGTCAGGCGGCGGCAGG + Intergenic
1141550009 16:84800539-84800561 CAGGAAATCCAAGCACTGGCAGG - Intergenic
1142034314 16:87854210-87854232 CAGGACAGACAGGCGGGGGCCGG + Intronic
1142233202 16:88909430-88909452 CAGGCAACCCCAGCGGCGGCTGG + Intronic
1142599926 17:1048665-1048687 GAGGTGATCCAGGCGGCAGCTGG - Intronic
1142750764 17:1986136-1986158 CAGGAAAACCAGGCGGGATCTGG + Intronic
1142847860 17:2690829-2690851 CAGGAAAGCCGGGAGGCGGGTGG - Intronic
1142878261 17:2865512-2865534 CAGGTAACCCAGGCTGCAGCCGG - Intronic
1145288164 17:21522002-21522024 CAGGAAAGCCAGGAGGCAGCAGG + Intergenic
1148520180 17:48266433-48266455 CAAGAAATCAAGGCTGTGGCTGG + Intronic
1148901663 17:50883216-50883238 CAGGGAAACCAGTAGGCGGCTGG - Intergenic
1150389591 17:64782485-64782507 CAGCACAGCCAGGCAGCGGCTGG + Intergenic
1150558440 17:66274728-66274750 CAGGAAGTCCAGGCTGCAGCCGG - Intergenic
1150782737 17:68135752-68135774 CATGAACTCGAGGCGGCGCCGGG - Intergenic
1150891403 17:69154496-69154518 CAGGAGATCAAGGCTGCAGCAGG - Intronic
1151512191 17:74567662-74567684 CAGAAAATCCAGATGGCAGCTGG - Intergenic
1151675602 17:75595844-75595866 CAGGACAGCCAGGAGGGGGCTGG + Intergenic
1151785569 17:76273386-76273408 AAAGACATCCAGGCGGCGGGTGG - Intergenic
1152264035 17:79283080-79283102 AAAGAAATCAAGGCGGGGGCGGG + Intronic
1152728987 17:81960822-81960844 CAGGAAGACCTGGCGGCGCCGGG - Exonic
1152756413 17:82088868-82088890 CAGGACAGCCTGGGGGCGGCAGG + Exonic
1153265161 18:3262335-3262357 CAGGGCGGCCAGGCGGCGGCAGG + Intronic
1153268758 18:3297402-3297424 GAGCAAAGCCAGGTGGCGGCTGG - Intergenic
1157107956 18:44792558-44792580 CAGGTACTCCAGGCGGTGGTGGG - Intronic
1157403992 18:47408529-47408551 CAGGAAAGCCAGGGTGTGGCTGG + Intergenic
1160817547 19:1043099-1043121 CAGCAACTCCAGGGGGCCGCTGG - Exonic
1161493394 19:4575016-4575038 AAGGGAATCCAGGCTGGGGCTGG + Intergenic
1163580808 19:18137527-18137549 CAGGAAATCCAGCCAGGGGGCGG - Intronic
1164626731 19:29734269-29734291 CTGGAAACCCAGGGGGTGGCGGG - Intergenic
1165245753 19:34497616-34497638 CAGGAGAACCAGGAGGCTGCCGG + Intronic
1167257907 19:48442345-48442367 CAGGAAGTCCATGCGGTGGGTGG - Exonic
926172029 2:10558563-10558585 CAGGAAAACCAGGCAACGGGAGG + Intergenic
927629686 2:24762092-24762114 AAGGGAATCCAGGCAGCGCCTGG - Intronic
933765573 2:85706388-85706410 GAGGAAAGTCAGGCAGCGGCAGG + Intergenic
935064880 2:99638756-99638778 CAGGAAAAACAGGCGGTGGGGGG - Intronic
936038190 2:109129146-109129168 CAGGAAGTGCGGGCAGCGGCCGG - Intergenic
936074954 2:109395855-109395877 CAGGAAATCCAGGCACCAACAGG - Intronic
937317621 2:120941888-120941910 CATGAAATCCAGGCGGCAGGGGG + Intronic
937887155 2:126907800-126907822 CAGGAACTCCCAGCGGAGGCAGG + Intergenic
937913375 2:127087195-127087217 CAGGACCTCCAGGGGCCGGCCGG - Intronic
938829417 2:135035741-135035763 CTGGAAATGCAGGCAGGGGCTGG - Intronic
941716975 2:168774282-168774304 CAGGAACTCCAGGAGGCTGAAGG - Exonic
943073803 2:183171865-183171887 CAGCAAATTCAGGCAGAGGCAGG + Intergenic
946009079 2:216550298-216550320 CTGGAAAGCCAGGCAGAGGCAGG - Intronic
946329597 2:219001894-219001916 CAGGAAAGCCGGGCGGAGGGTGG - Intergenic
948280462 2:236743329-236743351 TAGGAAATCCAGGGGTGGGCTGG + Intergenic
948866441 2:240777456-240777478 CAGGAAACCCAGGGGGCTGCTGG - Intronic
1169113304 20:3046611-3046633 CAGGATAGCGAGGCTGCGGCAGG + Exonic
1169130988 20:3166364-3166386 CAGGAAACGCAGGAGGGGGCTGG + Intronic
1172752325 20:37259455-37259477 CAAGAAAGCCAGGCTGCAGCTGG - Intronic
1174129552 20:48333132-48333154 CAGGAATTCAAGGCTGCGGTGGG - Intergenic
1175597028 20:60243465-60243487 CTGGAAATCCAGGTGTGGGCAGG + Intergenic
1175893283 20:62324703-62324725 CAGGAACTCCTGGCCTCGGCCGG + Intronic
1175973467 20:62698833-62698855 CAGGAAGTCCAGGGGACAGCAGG + Intergenic
1175973482 20:62698883-62698905 CAGGAAGCCCAGGGGGCAGCAGG + Intergenic
1175973497 20:62698933-62698955 CAGGAAGTCCAGGGGACAGCAGG + Intergenic
1175973510 20:62698984-62699006 CAGGAAGTCCAGGGGGCAGCAGG + Intergenic
1178430059 21:32510964-32510986 CAGGAATTCAAGGCTGCAGCAGG + Intronic
1178691363 21:34752747-34752769 AAGGAAAACAAGGCGGCGGGAGG - Intergenic
1181391712 22:22587992-22588014 CAGGAAATCCATGCCTAGGCTGG + Intergenic
1183664483 22:39239522-39239544 CAGGAAAACCAGGCTCCGGGCGG - Intronic
1184481837 22:44752625-44752647 CAGGTAAGGCGGGCGGCGGCGGG + Exonic
1185009111 22:48303254-48303276 CAGCAAATGTAGGCGGAGGCTGG - Intergenic
954295725 3:49673756-49673778 CGGGAGATCCACGCTGCGGCCGG + Intergenic
957831429 3:85526085-85526107 CAGGAAATCCAGGAGAGGCCTGG - Intronic
967388012 3:188929293-188929315 CAGGAAATCCAGGAGCGGGCAGG - Intergenic
967858424 3:194134792-194134814 CAGGAATCCGAGGGGGCGGCGGG - Intergenic
971207282 4:24583542-24583564 CAGGAAATACAGGAGATGGCGGG + Intronic
971500556 4:27313852-27313874 CAGGAAAGCCAGGCAGCACCTGG + Intergenic
973317896 4:48780316-48780338 CAGGAAGGCCAGGGGGCGGGCGG - Intronic
975800974 4:78058717-78058739 GAGGAAAACCAGGAGGCGGAGGG - Intronic
977757536 4:100690761-100690783 CAGGAAATCGAGGCTGCAGTGGG + Intronic
981014015 4:139954599-139954621 AAGGAAATCCAGGCAGCAACTGG + Intronic
984767970 4:183413999-183414021 CGGGAGAGTCAGGCGGCGGCAGG - Intergenic
985031396 4:185794279-185794301 GAGGAAATCCAGGCAGTGGGTGG + Intronic
985761837 5:1752961-1752983 CAGGACAGCCAGGCGGTGGGAGG + Intergenic
985886895 5:2686990-2687012 CAGGAAAAACAGGCGCCTGCAGG + Intergenic
987040994 5:14061918-14061940 CATGATATCCAGGAGGCAGCTGG + Intergenic
997745536 5:136296924-136296946 CAGGAACCCCAGGCAGGGGCAGG - Intronic
1001005088 5:168042880-168042902 CATGAAATCCAGGTGGCAGCTGG - Intronic
1001466897 5:171975390-171975412 CAGGATCTCCAGGCTGTGGCTGG - Intronic
1005824075 6:29622013-29622035 GAGGAAAGCCAGGCGGGGGCAGG - Intronic
1007084008 6:39130074-39130096 CAAGAAATCGAGGTGGAGGCTGG + Intergenic
1008753892 6:54770526-54770548 CAGGCACTGAAGGCGGCGGCAGG + Intergenic
1018379179 6:163241874-163241896 CAGGAATGCCAGACGGGGGCTGG - Intronic
1018716474 6:166536644-166536666 CAGGAGGTCCAGGCTGGGGCTGG - Intronic
1019476990 7:1249054-1249076 CGGGAAAGCCACGCGGAGGCAGG + Intergenic
1030490510 7:110227502-110227524 CAGGAAATACATGAGGCGGTGGG - Intergenic
1032321060 7:130887226-130887248 CAGTAAATCAAGGCTGCGGGTGG + Intergenic
1032525832 7:132577563-132577585 CCGGCAAGCCGGGCGGCGGCGGG - Intronic
1035068391 7:156123997-156124019 CAGGACACACAGGCGGAGGCAGG + Intergenic
1036222454 8:6932002-6932024 GAGGAATTCCAGGTGGTGGCAGG + Intergenic
1036229299 8:6985884-6985906 CAGGAATTCCAGGTGGTGGCAGG + Intergenic
1036231751 8:7004988-7005010 CAGGAATTCCAGGTGGTGGCAGG + Intronic
1036236787 8:7045690-7045712 GAGGAATTCCAGGTGGTGGCAGG + Intergenic
1044513733 8:93114289-93114311 GAGGAAATCCAGGAGGAAGCAGG - Intergenic
1046484573 8:114869822-114869844 CAGGAAATACAGGTGGCTTCAGG + Intergenic
1047430798 8:124789818-124789840 CAGGAGATCCAGAAGGTGGCAGG - Intergenic
1047659631 8:127019007-127019029 CAGGAAATCCAGGCAGTGATTGG + Intergenic
1049444670 8:142624487-142624509 CAGGGCATCCAGACGGAGGCTGG + Intergenic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1049809032 8:144555037-144555059 CAGGATATCCAGGCAGAGGCAGG - Intronic
1052358486 9:27529344-27529366 CCAGAAACCCAGGCGCCGGCAGG + Intronic
1055148680 9:72967700-72967722 AAAGAAATCCAGGCTGAGGCAGG - Intronic
1055757603 9:79572609-79572631 CAGGAACGCGCGGCGGCGGCTGG - Exonic
1057390731 9:94639694-94639716 CAGGAAGACTAGGGGGCGGCAGG - Intronic
1057444316 9:95103308-95103330 CAGGTTTTCCAGGCGGCTGCAGG - Intronic
1058818125 9:108704372-108704394 CAGGAAATCCAGGGTGGGGTGGG - Intergenic
1061502937 9:131014013-131014035 CAGGAGGTCAAGGCAGCGGCTGG + Intronic
1062533593 9:137012101-137012123 CAGGTAATCCAGGGAGAGGCTGG + Exonic
1185569560 X:1123205-1123227 AAGGAAATCCAGAAGGCTGCCGG - Intergenic
1195282585 X:103350350-103350372 CAGGAAACTCAGGAGGAGGCTGG + Intergenic
1198387515 X:136143843-136143865 CAGGAAATACGGGGGGGGGCGGG + Intergenic