ID: 1110706261

View in Genome Browser
Species Human (GRCh38)
Location 13:78603706-78603728
Sequence GCGCGCGCGCGCAGACGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110706261_1110706265 5 Left 1110706261 13:78603706-78603728 CCCGTGCGTCTGCGCGCGCGCGC 0: 1
1: 0
2: 0
3: 16
4: 113
Right 1110706265 13:78603734-78603756 TCCGGCCGCGACCAGCGCGTGGG 0: 1
1: 0
2: 0
3: 3
4: 40
1110706261_1110706264 4 Left 1110706261 13:78603706-78603728 CCCGTGCGTCTGCGCGCGCGCGC 0: 1
1: 0
2: 0
3: 16
4: 113
Right 1110706264 13:78603733-78603755 GTCCGGCCGCGACCAGCGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110706261 Original CRISPR GCGCGCGCGCGCAGACGCAC GGG (reversed) Intergenic
900671431 1:3857215-3857237 TCGCGCACGCGCAGAGGCCCTGG - Intergenic
906204336 1:43979179-43979201 GGGCGCGCGCGCGGGCGCGCGGG + Intronic
915572386 1:156751576-156751598 GCGCGCGGGCGGAGACGCCGTGG - Intronic
916003127 1:160635349-160635371 GCGCGCGCGCGCATGTACACGGG + Intronic
920704803 1:208243431-208243453 GCGCGCGATCGCAGGCTCACTGG - Intronic
922811048 1:228415941-228415963 ACACGCGCGCACACACGCACAGG + Exonic
922958558 1:229625815-229625837 GCGCGCGCGCGCGGGCGGGCGGG - Intronic
923650283 1:235867003-235867025 GGGCGCACGCGCAGACGAGCGGG - Intronic
1063928464 10:11004402-11004424 ACGCGCGCGCACACACACACAGG - Intergenic
1068620460 10:59176469-59176491 GCGCGTGCGCGCAGAAGGGCGGG + Intergenic
1071527414 10:86366510-86366532 GCGCGCGGGGGAAGACGCACGGG - Intergenic
1075714273 10:124547033-124547055 GCACACGCGCGCACACACACAGG + Intronic
1075871655 10:125775576-125775598 GCGCACGCGCGCACAGGCACAGG - Intronic
1075940717 10:126388339-126388361 GCGCACGCACGCACACACACGGG - Exonic
1076579534 10:131497448-131497470 GCGCGCGCGCACACACACACTGG + Intergenic
1078988026 11:16613594-16613616 GCGCGCGCGCGTGGAGGCAGCGG - Intronic
1089102570 11:115975878-115975900 GCGCGCGCGCGCGCATGAACTGG + Intergenic
1092899369 12:13044371-13044393 GCGGGCGCGCGCACGCGCACCGG + Exonic
1093711725 12:22335312-22335334 GGGCGCGCGCGCACACACACGGG - Intronic
1096101298 12:48971836-48971858 GCGCGCGCGCGCGCGCGCGCTGG - Intergenic
1097854880 12:64452050-64452072 GTGCGCACGCGCACCCGCACCGG + Exonic
1101354718 12:103966121-103966143 GCGCGCGCGCGCGCACGCAGGGG + Intronic
1101548348 12:105738274-105738296 ACGCGCGCGCACACACACACGGG + Intergenic
1101641257 12:106586979-106587001 GTGCGCGCGCGCGGGCGAACGGG + Intronic
1102677268 12:114667420-114667442 GCGCGCTCGGGCAGAGGCAGGGG - Intergenic
1102933559 12:116879766-116879788 CCCCGCGGGCGCAGACGCTCGGG + Intronic
1103085822 12:118061196-118061218 GGGCGCGGGCGGAGACGCGCGGG + Intronic
1105746481 13:23381430-23381452 GCGCGCGCACACACACACACAGG + Intronic
1105964645 13:25372875-25372897 GCGCGCGCACACACACACACAGG + Intronic
1109386735 13:61638997-61639019 GCGCGCGCGCACACACACAGTGG + Intergenic
1110706261 13:78603706-78603728 GCGCGCGCGCGCAGACGCACGGG - Intergenic
1112508762 13:99990821-99990843 GTGCGCGCGCGCAAAGGCAAGGG - Intergenic
1113517387 13:110914378-110914400 GCGCGCGCGCGCGCTCGCACAGG + Intronic
1113820364 13:113209012-113209034 GCGCGCGCGCCCCGAGGCCCTGG - Intronic
1125201017 15:37100746-37100768 GCGCGCGCGCGCGCGCGAACAGG + Intronic
1125201111 15:37101355-37101377 GCGCGCGCGCACGGGCGCGCGGG - Intergenic
1130849322 15:87778448-87778470 GCGCGCGCGCGCGTGCACACAGG - Intergenic
1132543448 16:522018-522040 GCGCGCGCACACACACGCAGCGG - Exonic
1137426613 16:48385510-48385532 TCGCGGGCGCGCAGGCGCACAGG + Intronic
1139390415 16:66604114-66604136 GCGCGCGCGCAAACACACACAGG - Exonic
1139615479 16:68085885-68085907 GCGCGCGCACACACACACACAGG - Intronic
1141694456 16:85613091-85613113 GCGCGCGCGCGCGCACCGACGGG - Intronic
1141990211 16:87604978-87605000 GCGCGCGCACACACACACACAGG - Intronic
1144107243 17:11997285-11997307 CCGCGCGCTCCCAGACGCATGGG + Exonic
1144787472 17:17840106-17840128 GCGCGCGTGCGGAGCCGCCCCGG - Intergenic
1146033919 17:29390225-29390247 GCGCGCGCGCGCGCCCTCACAGG - Intergenic
1146182312 17:30706189-30706211 GCGTGCGCGCGCGGACGCCTTGG + Intergenic
1146183302 17:30710167-30710189 GGACCCGCGCGCACACGCACCGG - Intergenic
1147864957 17:43545983-43546005 GCGCGCGCGCGCGGAGGAGCAGG + Intronic
1152417680 17:80173330-80173352 GCGCGCGCGCGCGGAATGACAGG + Intronic
1153985409 18:10346547-10346569 GCGCGCACACGCACACACACAGG + Intergenic
1156099774 18:33578849-33578871 GCGCGCGCACGCACACACACAGG - Intronic
1157097259 18:44697171-44697193 GCGCGTGTGAGCACACGCACAGG - Intronic
1157464261 18:47930686-47930708 GCGCGCGCCCGCAGCCCTACCGG + Intronic
1157794067 18:50559539-50559561 GCGCGCGCGGGAAGGGGCACTGG - Intergenic
1160767083 19:813420-813442 GCGGGCGCGCGCAGGTGCCCGGG + Exonic
1161029573 19:2051375-2051397 GCCGGAGCGCGCAGCCGCACTGG - Intergenic
1162524095 19:11197524-11197546 CGGCGCGCGCGAAGACGCTCGGG - Exonic
1162951328 19:14073488-14073510 GGGCGGGCGCGCAGATGCAGCGG + Exonic
1162975486 19:14205587-14205609 GCACCCGCGCGCACACGCACCGG + Intronic
1162976521 19:14209613-14209635 GCGTGCGCGCGCGGACGCCTTGG - Intergenic
1163649607 19:18509572-18509594 GCGCGCGCGCGCACGTGCATTGG - Intronic
1165812307 19:38618888-38618910 GCGTGCGCGCGCGAACTCACCGG - Intergenic
1166043614 19:40217226-40217248 GCGCGCGTGCGTAGTCGCCCAGG + Exonic
1166759468 19:45215728-45215750 GCACACGGGCGCACACGCACTGG - Intronic
1167156812 19:47743607-47743629 GTGTGCGCGCGCTCACGCACCGG + Intergenic
1168076437 19:53982879-53982901 GCGCGCCCGCGCACGCGCCCCGG - Exonic
927702530 2:25277151-25277173 GCGCGCCCGCCCACGCGCACAGG - Intronic
928493347 2:31806017-31806039 ACGCGCGTGCGCACACACACTGG - Intergenic
932699976 2:73985402-73985424 CCGCGCGCGCGCCGCCGCTCGGG - Intergenic
935137818 2:100322491-100322513 GGACGCGCGCGCAGTCGCGCAGG - Exonic
937203895 2:120223583-120223605 GCGCGCGCGAGCAGAGGCGGTGG + Intergenic
945033360 2:205684942-205684964 GCGCGCGAGCGCGCACACACTGG + Intronic
945319615 2:208406695-208406717 GAGCGCGAGCGCAGCCGCGCGGG + Intronic
946621883 2:221571136-221571158 GCACGCGCGCGCACACACACAGG + Intronic
946692432 2:222319542-222319564 GCGGGCGCGGGCAGGCGCGCGGG + Intergenic
948118862 2:235514139-235514161 GCGCGCGCACGCGCATGCACTGG - Intronic
948941952 2:241201156-241201178 TGGCGCGCACGCAGAAGCACAGG - Intronic
1172489224 20:35321286-35321308 GCGCGCGCGCGCGCACGCTCAGG + Intronic
1172841291 20:37903945-37903967 GCGCGCGCGCACACACACACAGG + Intronic
1176024892 20:62980962-62980984 GGCCGCGCGCCCAGACCCACCGG + Intergenic
1176548953 21:8213385-8213407 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1176556846 21:8257597-8257619 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1185285919 22:49999814-49999836 GCGCGGGCGCTCACTCGCACAGG + Exonic
1203253837 22_KI270733v1_random:129692-129714 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
1203261893 22_KI270733v1_random:174771-174793 GGGCGCGCGCGCGTACGCGCGGG - Intergenic
950282421 3:11719510-11719532 CCGAGGGCGCGCAGACGCACAGG + Intronic
950610706 3:14125011-14125033 GCGCGCATGCGCAGAAACACTGG + Exonic
951674194 3:25218296-25218318 GCACACGCGCGCACACACACTGG - Intronic
956825888 3:72996790-72996812 GCGTGCGCGCGGTGACGTACCGG + Exonic
961389152 3:126542182-126542204 GCGCGCGCTCCCCGACGCCCGGG + Exonic
961574540 3:127823498-127823520 ACGCGCGCACACAGACCCACAGG + Intergenic
964430471 3:156600518-156600540 GCGCGCGCGCGCGCATGCACTGG + Intergenic
964518859 3:157542597-157542619 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
969362630 4:6674319-6674341 GCGAGCGCGCCCGGGCGCACTGG + Intergenic
970826544 4:20283097-20283119 GCGCGCGCACACAGGCACACAGG - Intronic
977908463 4:102502367-102502389 GCGCGCGCGCGCGCACGGAGGGG - Intronic
982184187 4:152779716-152779738 GCGCGCGGGGCCAGAGGCACCGG - Exonic
986976046 5:13395291-13395313 GCGCGCGCGCACGCGCGCACTGG - Intergenic
987274841 5:16351639-16351661 GCGCGCGCACACACACACACAGG + Intergenic
992837420 5:80654640-80654662 GCTCGCGCCCGCAGACGCCTGGG + Exonic
993168398 5:84384710-84384732 GCGCGGGCAGGCAGACCCACCGG + Exonic
993919146 5:93779125-93779147 GCGCGCGCGCGCGCACGTGCAGG + Intronic
993919148 5:93779127-93779149 GCGCGCGCGCGCACGTGCAGGGG + Intronic
998131267 5:139652145-139652167 GCGCGCGCGCGCGCGCGCGCCGG - Intronic
1002839369 6:892859-892881 GCGTGGGAGCGCAGACTCACTGG + Intergenic
1002888251 6:1313695-1313717 TCGCGCGCGCCCAGCCGCGCCGG - Exonic
1003427548 6:6007663-6007685 GCGAGCGCGCGCACACGCCCAGG + Intergenic
1004174552 6:13328465-13328487 CCGCGCGCGCCCAGACGGCCCGG + Intronic
1015724805 6:136289369-136289391 TCGGGCGCGCGCAGAGGTACGGG + Intronic
1018329953 6:162716747-162716769 GCGCGCGCGCGCAGGCGGGTAGG - Intronic
1019381636 7:727182-727204 GCGCGAGCGCGGCGCCGCACAGG - Exonic
1019728511 7:2616783-2616805 GCGCACGCGCACAGGCACACGGG + Intergenic
1031051951 7:116953775-116953797 GCGCGCGCTCGGGGACGCGCCGG + Intronic
1032013408 7:128360964-128360986 GCGCGCGCGTGCAGGGGCAGGGG - Intronic
1037575270 8:20197170-20197192 GCGCGCGGGCGCAGAGGGAAGGG - Intergenic
1037900476 8:22685425-22685447 GCGCGCGCGCGCGCGCGCGCGGG + Intergenic
1038554012 8:28494155-28494177 ACGAGCGCGCGCGCACGCACGGG - Intergenic
1043502980 8:80874402-80874424 GCGCGCGGGCGCAGCCGGCCGGG - Intronic
1048882192 8:138880335-138880357 GCGCGTGCACACACACGCACAGG - Intronic
1049714318 8:144082749-144082771 GCGAGCGCGCGCCGGCGAACCGG - Exonic
1049772982 8:144392314-144392336 GAGGGCGCACGCAGCCGCACTGG + Exonic
1049798872 8:144508729-144508751 GCGCCCGCGAGCTGACGCTCTGG + Intergenic
1056207864 9:84337431-84337453 ACACGCGCGCGCACACACACAGG - Intronic
1057076591 9:92141385-92141407 GGCCAGGCGCGCAGACGCACGGG - Intergenic
1058602538 9:106685482-106685504 ACGCGCGCGCGCGCGCGCACAGG - Intergenic
1187067551 X:15855069-15855091 GCGCGGGCGCGCGGGCGCTCGGG - Intergenic
1189974384 X:46447183-46447205 CCGCGCACGCGCAGTAGCACGGG - Exonic
1190096117 X:47482592-47482614 GCGCACGCGCACGCACGCACCGG - Exonic
1196180110 X:112680193-112680215 GAGCGCGCGCGCATGCGCGCAGG + Intergenic