ID: 1110707152

View in Genome Browser
Species Human (GRCh38)
Location 13:78608907-78608929
Sequence CACAGCTTCCAGACCCTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110707152_1110707155 -8 Left 1110707152 13:78608907-78608929 CCCAAAAGGGTCTGGAAGCTGTG No data
Right 1110707155 13:78608922-78608944 AAGCTGTGGAGAAAACCGCAAGG No data
1110707152_1110707157 18 Left 1110707152 13:78608907-78608929 CCCAAAAGGGTCTGGAAGCTGTG No data
Right 1110707157 13:78608948-78608970 CGAGTCCAAACCCGAGAGTGCGG No data
1110707152_1110707160 25 Left 1110707152 13:78608907-78608929 CCCAAAAGGGTCTGGAAGCTGTG No data
Right 1110707160 13:78608955-78608977 AAACCCGAGAGTGCGGAGCTGGG No data
1110707152_1110707159 24 Left 1110707152 13:78608907-78608929 CCCAAAAGGGTCTGGAAGCTGTG No data
Right 1110707159 13:78608954-78608976 CAAACCCGAGAGTGCGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110707152 Original CRISPR CACAGCTTCCAGACCCTTTT GGG (reversed) Intergenic
No off target data available for this crispr