ID: 1110707153

View in Genome Browser
Species Human (GRCh38)
Location 13:78608908-78608930
Sequence CCACAGCTTCCAGACCCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110707153_1110707159 23 Left 1110707153 13:78608908-78608930 CCAAAAGGGTCTGGAAGCTGTGG No data
Right 1110707159 13:78608954-78608976 CAAACCCGAGAGTGCGGAGCTGG No data
1110707153_1110707157 17 Left 1110707153 13:78608908-78608930 CCAAAAGGGTCTGGAAGCTGTGG No data
Right 1110707157 13:78608948-78608970 CGAGTCCAAACCCGAGAGTGCGG No data
1110707153_1110707160 24 Left 1110707153 13:78608908-78608930 CCAAAAGGGTCTGGAAGCTGTGG No data
Right 1110707160 13:78608955-78608977 AAACCCGAGAGTGCGGAGCTGGG No data
1110707153_1110707155 -9 Left 1110707153 13:78608908-78608930 CCAAAAGGGTCTGGAAGCTGTGG No data
Right 1110707155 13:78608922-78608944 AAGCTGTGGAGAAAACCGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110707153 Original CRISPR CCACAGCTTCCAGACCCTTT TGG (reversed) Intergenic