ID: 1110707155

View in Genome Browser
Species Human (GRCh38)
Location 13:78608922-78608944
Sequence AAGCTGTGGAGAAAACCGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110707153_1110707155 -9 Left 1110707153 13:78608908-78608930 CCAAAAGGGTCTGGAAGCTGTGG No data
Right 1110707155 13:78608922-78608944 AAGCTGTGGAGAAAACCGCAAGG No data
1110707145_1110707155 17 Left 1110707145 13:78608882-78608904 CCGCTCTGCCTCCAGGAGCAAGA No data
Right 1110707155 13:78608922-78608944 AAGCTGTGGAGAAAACCGCAAGG No data
1110707147_1110707155 6 Left 1110707147 13:78608893-78608915 CCAGGAGCAAGATCCCCAAAAGG No data
Right 1110707155 13:78608922-78608944 AAGCTGTGGAGAAAACCGCAAGG No data
1110707143_1110707155 26 Left 1110707143 13:78608873-78608895 CCGCAGGCTCCGCTCTGCCTCCA No data
Right 1110707155 13:78608922-78608944 AAGCTGTGGAGAAAACCGCAAGG No data
1110707152_1110707155 -8 Left 1110707152 13:78608907-78608929 CCCAAAAGGGTCTGGAAGCTGTG No data
Right 1110707155 13:78608922-78608944 AAGCTGTGGAGAAAACCGCAAGG No data
1110707146_1110707155 9 Left 1110707146 13:78608890-78608912 CCTCCAGGAGCAAGATCCCCAAA No data
Right 1110707155 13:78608922-78608944 AAGCTGTGGAGAAAACCGCAAGG No data
1110707151_1110707155 -7 Left 1110707151 13:78608906-78608928 CCCCAAAAGGGTCTGGAAGCTGT No data
Right 1110707155 13:78608922-78608944 AAGCTGTGGAGAAAACCGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110707155 Original CRISPR AAGCTGTGGAGAAAACCGCA AGG Intergenic
No off target data available for this crispr