ID: 1110707156

View in Genome Browser
Species Human (GRCh38)
Location 13:78608937-78608959
Sequence GGTTTGGACTCGCGTCCTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110707156_1110707159 -6 Left 1110707156 13:78608937-78608959 CCGCAAGGACGCGAGTCCAAACC No data
Right 1110707159 13:78608954-78608976 CAAACCCGAGAGTGCGGAGCTGG No data
1110707156_1110707165 24 Left 1110707156 13:78608937-78608959 CCGCAAGGACGCGAGTCCAAACC No data
Right 1110707165 13:78608984-78609006 CACCCGGCTCCAACGCTCGCCGG No data
1110707156_1110707163 8 Left 1110707156 13:78608937-78608959 CCGCAAGGACGCGAGTCCAAACC No data
Right 1110707163 13:78608968-78608990 CGGAGCTGGGTCCTGTCACCCGG No data
1110707156_1110707160 -5 Left 1110707156 13:78608937-78608959 CCGCAAGGACGCGAGTCCAAACC No data
Right 1110707160 13:78608955-78608977 AAACCCGAGAGTGCGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110707156 Original CRISPR GGTTTGGACTCGCGTCCTTG CGG (reversed) Intergenic
No off target data available for this crispr