ID: 1110707157

View in Genome Browser
Species Human (GRCh38)
Location 13:78608948-78608970
Sequence CGAGTCCAAACCCGAGAGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110707152_1110707157 18 Left 1110707152 13:78608907-78608929 CCCAAAAGGGTCTGGAAGCTGTG No data
Right 1110707157 13:78608948-78608970 CGAGTCCAAACCCGAGAGTGCGG No data
1110707151_1110707157 19 Left 1110707151 13:78608906-78608928 CCCCAAAAGGGTCTGGAAGCTGT No data
Right 1110707157 13:78608948-78608970 CGAGTCCAAACCCGAGAGTGCGG No data
1110707153_1110707157 17 Left 1110707153 13:78608908-78608930 CCAAAAGGGTCTGGAAGCTGTGG No data
Right 1110707157 13:78608948-78608970 CGAGTCCAAACCCGAGAGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110707157 Original CRISPR CGAGTCCAAACCCGAGAGTG CGG Intergenic
No off target data available for this crispr