ID: 1110707160

View in Genome Browser
Species Human (GRCh38)
Location 13:78608955-78608977
Sequence AAACCCGAGAGTGCGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110707151_1110707160 26 Left 1110707151 13:78608906-78608928 CCCCAAAAGGGTCTGGAAGCTGT No data
Right 1110707160 13:78608955-78608977 AAACCCGAGAGTGCGGAGCTGGG No data
1110707152_1110707160 25 Left 1110707152 13:78608907-78608929 CCCAAAAGGGTCTGGAAGCTGTG No data
Right 1110707160 13:78608955-78608977 AAACCCGAGAGTGCGGAGCTGGG No data
1110707156_1110707160 -5 Left 1110707156 13:78608937-78608959 CCGCAAGGACGCGAGTCCAAACC No data
Right 1110707160 13:78608955-78608977 AAACCCGAGAGTGCGGAGCTGGG No data
1110707153_1110707160 24 Left 1110707153 13:78608908-78608930 CCAAAAGGGTCTGGAAGCTGTGG No data
Right 1110707160 13:78608955-78608977 AAACCCGAGAGTGCGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110707160 Original CRISPR AAACCCGAGAGTGCGGAGCT GGG Intergenic
No off target data available for this crispr