ID: 1110709689

View in Genome Browser
Species Human (GRCh38)
Location 13:78636610-78636632
Sequence CCTAGAGCCCAGAGGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110709689_1110709695 19 Left 1110709689 13:78636610-78636632 CCAGGTTCCCTCTGGGCTCTAGG 0: 1
1: 0
2: 3
3: 21
4: 200
Right 1110709695 13:78636652-78636674 ATGCACACCAACCAGGACTGTGG 0: 1
1: 0
2: 0
3: 10
4: 126
1110709689_1110709694 12 Left 1110709689 13:78636610-78636632 CCAGGTTCCCTCTGGGCTCTAGG 0: 1
1: 0
2: 3
3: 21
4: 200
Right 1110709694 13:78636645-78636667 TTCATGAATGCACACCAACCAGG 0: 1
1: 0
2: 0
3: 16
4: 437

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110709689 Original CRISPR CCTAGAGCCCAGAGGGAACC TGG (reversed) Intronic
900136981 1:1121844-1121866 CCGAGAGCCCAGTGGGCATCAGG - Intergenic
900142906 1:1145936-1145958 CCCAGACCCCAGAGGGTGCCAGG - Intergenic
900337853 1:2173655-2173677 CCGACAGCCCAGAGGCAGCCTGG + Intronic
900641560 1:3690218-3690240 CCTAGACCCCCGAGGGAGACAGG - Intronic
901479088 1:9511812-9511834 CCTACACCCCGGAGTGAACCAGG - Intergenic
901701106 1:11045152-11045174 CCCAGAGCCCAGGTGGAACCAGG + Intronic
901771863 1:11534641-11534663 CCAAGAGCCCTGAGGAAACCGGG + Intronic
902197148 1:14806139-14806161 CCTAAAGGCCAGAGGAACCCTGG - Intronic
902930112 1:19725176-19725198 CCTAGGGCCCAGAGTGAAGCAGG + Intronic
903469296 1:23574524-23574546 CCTAGAGGCCAGAGAGAATGTGG - Intergenic
903809661 1:26028411-26028433 ACTAGGGCCCAGAGGGTACTAGG - Intronic
904962655 1:34346861-34346883 CCTAGAGGACAGACAGAACCAGG - Intergenic
905013288 1:34761159-34761181 CCTTGAGGCCTGGGGGAACCTGG - Exonic
905714853 1:40140198-40140220 CCTAGAGCCCAGAGGAAGCATGG - Intergenic
906670052 1:47647744-47647766 CCAAGACCCCATTGGGAACCAGG + Intergenic
912525485 1:110279768-110279790 CCTAAAGCCCACAGGGAACCAGG - Intronic
916243700 1:162665381-162665403 CCTAGGGCCATGAGGGAACAAGG - Intronic
920970829 1:210742458-210742480 CCTTGAGCCCATAGGAAAGCAGG - Intronic
922467675 1:225855491-225855513 CCCAGAGCCCAGAGGCATCCTGG + Intronic
922730289 1:227945860-227945882 CCAGCAGCCCAGATGGAACCTGG + Intronic
924709732 1:246522360-246522382 CCTGAAACCCAGAGGGAGCCAGG + Intergenic
1062863075 10:825260-825282 CCTAGTGCAGAGAGGGGACCTGG - Exonic
1062974452 10:1672994-1673016 CCAACAGCCCGGAGGGGACCAGG + Intronic
1064313566 10:14234424-14234446 CCTGGATCTCAGAGGGATCCCGG + Intronic
1067083537 10:43226601-43226623 CCTGGAACCCACAGGGACCCAGG + Intronic
1067300846 10:45007799-45007821 CTTAAATCCCAGAGAGAACCTGG + Intergenic
1067786537 10:49253549-49253571 CGTAGAGACCACAGGAAACCTGG - Intergenic
1067941695 10:50661860-50661882 CCTAAAGCCAAGAGGTAGCCAGG - Intergenic
1069430245 10:68328561-68328583 CATAGAGATCAGAGGGACCCTGG - Intronic
1069822593 10:71236785-71236807 TCAAGAGGCCAGAGGGACCCTGG + Intronic
1070699316 10:78588182-78588204 TTTGGAGCCCAGAGGGAGCCAGG + Intergenic
1072270387 10:93770525-93770547 CTCAGAGTTCAGAGGGAACCAGG - Intronic
1072418329 10:95268376-95268398 CCTAGAGCCTAGAAGAAATCGGG - Intronic
1073577875 10:104640704-104640726 TCTAGAGCCGAGAGGGAGCCAGG - Intergenic
1074471765 10:113733686-113733708 CCTAGAGCCCAGTGGACACTGGG + Intergenic
1075183104 10:120229747-120229769 ACTAGAGACTAGAGGGAACCAGG - Intergenic
1075253142 10:120900280-120900302 CCGAGAACCCAGAGGCAGCCTGG - Intronic
1076748425 10:132526918-132526940 CCCAGAGCCCAGAGGAAAGGAGG + Intergenic
1076751502 10:132545704-132545726 CTCAGAGCCCGGTGGGAACCAGG + Intronic
1077077695 11:708853-708875 CCTGAAGTCCAGAGGGAGCCCGG - Intronic
1078352293 11:10604206-10604228 TCCACAGCCCTGAGGGAACCAGG + Intronic
1079454466 11:20624713-20624735 CCGAGAGCCCAGAGTGGGCCTGG + Intronic
1080247312 11:30194395-30194417 CCTATAGCCCACAGAAAACCAGG - Intergenic
1081570817 11:44289763-44289785 CTTAGAGCCCAGACTGAAGCTGG - Intronic
1083484021 11:62971709-62971731 CCTGTAACCCAGAGGGAAACCGG - Intronic
1083731361 11:64654193-64654215 CTCAGAGCCCAGAGGGGAACAGG - Intronic
1083955583 11:65981240-65981262 GCTAGAGCCCAGGTGGAGCCAGG + Intergenic
1084460714 11:69295117-69295139 CCTAGAGGCCATGGGGACCCAGG + Intronic
1085522550 11:77146878-77146900 CCCAGGGCCCTGAGGAAACCAGG + Intronic
1085657231 11:78327584-78327606 TCTAGAGCCTACAGGGAGCCAGG + Intronic
1089004243 11:115077660-115077682 CCTAGATTCGAGAGGGAACAAGG - Intergenic
1089101153 11:115963716-115963738 CCCAGAGCCCAGAGAGATGCAGG - Intergenic
1089327668 11:117668507-117668529 GCTATAGCCCAGCGGGTACCTGG + Intronic
1089832148 11:121338254-121338276 CCAAGACCCCAGAGAGACCCTGG + Intergenic
1090362012 11:126179787-126179809 CCTAGAGGACAGAGGGACACAGG - Intergenic
1091184284 11:133633916-133633938 ACTAGAGACCAGGGGAAACCAGG - Intergenic
1096525975 12:52210733-52210755 CCCAGGGCCCAGAGAGACCCAGG - Intergenic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1098764804 12:74472457-74472479 CTGAGAGCCCAGAGGAAACAAGG + Intergenic
1098869210 12:75797989-75798011 TGTAGAGCCCAGAGGAAACATGG + Intergenic
1100765153 12:97856016-97856038 ACTAGAGCTCAGAGGGAAAACGG + Intergenic
1101738439 12:107481398-107481420 CCTGGTGCTCAGAGGGAACCAGG - Intronic
1105706589 13:22971201-22971223 CCTAGAGGCCACAGGGAAAATGG - Intergenic
1110709689 13:78636610-78636632 CCTAGAGCCCAGAGGGAACCTGG - Intronic
1111030600 13:82592462-82592484 CCTAGACCCTAGTGGGAGCCAGG + Intergenic
1111924249 13:94445958-94445980 CCTGGAACCCAGAGGGGGCCAGG - Intronic
1112913751 13:104522021-104522043 TCCAGAGGCCGGAGGGAACCAGG - Intergenic
1113424210 13:110194533-110194555 CCGAGAGCCCAGAGTGAAGCTGG + Intronic
1113797333 13:113066117-113066139 CTCAGAGCCCAGTGTGAACCAGG + Exonic
1114219454 14:20683723-20683745 GCTAGGGCCTGGAGGGAACCTGG - Intergenic
1115239205 14:31238125-31238147 CCTAGAGACCAGAGAAAACTTGG - Intergenic
1117444857 14:55794404-55794426 GGTAAAGACCAGAGGGAACCAGG + Intergenic
1118378876 14:65201505-65201527 CCTGGAGCCCAGAGAGAAGGGGG + Intergenic
1118764793 14:68902469-68902491 TCTGGAGCCCAGAAGGTACCCGG - Exonic
1119690714 14:76670097-76670119 CCTAGAGCACTGAGGAACCCTGG - Intergenic
1122094822 14:99363129-99363151 CCCAGAGCCCAGAGAGCAGCTGG + Intergenic
1122306862 14:100772064-100772086 CCTAGAGTCCAGAGAGAGCTGGG + Intergenic
1126336471 15:47590796-47590818 CCCAGAGTTCAGAGGGAACATGG + Intronic
1127304350 15:57690514-57690536 CCTAGGGCCCAGAGAGTGCCTGG + Intronic
1127795642 15:62436209-62436231 CCTGGAACTCAGAGGGAACGTGG - Intronic
1127901694 15:63345719-63345741 CCTGGAGCCCAGAGAGAGGCAGG + Intronic
1129108011 15:73322527-73322549 GCTGGACCCCAGAGGGAACCTGG - Exonic
1129929319 15:79396554-79396576 ACTGGAGCCCAGAGGGAAGATGG - Intronic
1130167749 15:81480947-81480969 CCAAGAGCCCAGAGAGAGGCGGG + Intergenic
1130172571 15:81531055-81531077 CCAAGATCCCAGAGGTATCCAGG + Intergenic
1131585613 15:93689761-93689783 CTTGGAGCCTAGAGGGAACAGGG + Intergenic
1132498080 16:273244-273266 CCTTGGGCCCAGAGAGAAGCTGG + Intronic
1132802010 16:1759145-1759167 CCCACAGCCCAGAGGCAGCCTGG - Intronic
1132925577 16:2427659-2427681 CCTGAAGCCCAGTGGGAAACGGG + Intergenic
1136377892 16:29876389-29876411 CGGGGAGCCCAGTGGGAACCTGG + Intronic
1137290295 16:47047955-47047977 CCCTGAGCTCAGAGGGCACCAGG - Intergenic
1137444453 16:48523289-48523311 CCTGGAGCCCTTAGGGATCCTGG - Intergenic
1137576775 16:49605135-49605157 CCTGGAGCTCGGTGGGAACCTGG - Intronic
1137624686 16:49900192-49900214 CCAGGGGCCCAGAGGGCACCTGG - Intergenic
1138517068 16:57541972-57541994 CCTGAAGCCCAGAGAGGACCTGG - Intergenic
1138599887 16:58047953-58047975 CCAAAAGCCCAGAGGTCACCGGG + Intergenic
1139662195 16:68428847-68428869 CAGAGAGCCCAGAGGAGACCAGG + Intronic
1141519818 16:84571319-84571341 ACTAAGGCCCAGAGGGAGCCCGG - Intronic
1141659033 16:85431732-85431754 CCCAGGGCCCAGAGGGTATCTGG + Intergenic
1141698958 16:85633712-85633734 CCCAGAGTCCAGCTGGAACCCGG - Intronic
1142849754 17:2698666-2698688 CCTAGACCGCGGAGGCAACCGGG + Intronic
1144408357 17:14974598-14974620 CCTCGAGCCCAAAGGGAAGAGGG - Intergenic
1147150485 17:38511008-38511030 CCTAGAGCCCCTTTGGAACCAGG + Exonic
1149239867 17:54636193-54636215 CCTAGAGCCCTGAGTGAACATGG + Intergenic
1150234420 17:63581431-63581453 CCTATAGGCCAGAGGGACCATGG + Intronic
1150290726 17:63980080-63980102 ACTAAGGCCCAGAGGGGACCAGG + Intergenic
1151826977 17:76529193-76529215 CCTCGAGCCCATGGGGACCCTGG + Intronic
1153068071 18:1070210-1070232 CCTAGAGCTCACATAGAACCAGG - Intergenic
1153954497 18:10084819-10084841 CCCAGAGCCCATAGGGAATGAGG + Intergenic
1154147634 18:11879525-11879547 CCTAGAGAGAAGAGGAAACCAGG - Intronic
1155158504 18:23177588-23177610 AAAAGAGCCCAGCGGGAACCAGG - Intronic
1155162736 18:23208782-23208804 CCTGGGGCTCAGAGGGAACATGG - Intronic
1162524468 19:11199398-11199420 CCCACAGCCCAGTGGGCACCAGG + Exonic
1163151848 19:15419777-15419799 TCTCGAGCCCAGAGTGAATCAGG - Intergenic
1163326607 19:16607599-16607621 CCCGGAGCCCTGAGAGAACCCGG + Intronic
1163633885 19:18429675-18429697 GCCAGAGCCCAGAGGGGACCTGG + Intronic
1165829175 19:38722050-38722072 CATAGGTCCCTGAGGGAACCAGG + Intronic
1166544688 19:43626993-43627015 CCCAGCGACCATAGGGAACCAGG + Intronic
1167774359 19:51545027-51545049 CCTGGAGCCCAGATGCAACAGGG + Intergenic
925800939 2:7599720-7599742 CATAGTGCCCAGAGCGCACCGGG + Intergenic
926155671 2:10452597-10452619 CCTGGAGCCCAGAAGGGCCCTGG + Intergenic
926887645 2:17612726-17612748 GTTAAAGCCCAGAGGCAACCTGG - Intronic
927679020 2:25127934-25127956 GCTGGAGCCCAGATGGTACCAGG + Intronic
929934751 2:46286492-46286514 CCTAGGATCCAGAGGGATCCTGG - Intergenic
931443503 2:62307766-62307788 CCTAGAGCTGACAGGGCACCAGG + Intergenic
932718337 2:74120052-74120074 CCTAGAGGCCCGAGGTAACAGGG - Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
933275013 2:80274422-80274444 CCCACAGCCCAGAGCGAACTGGG - Intronic
933748716 2:85589393-85589415 CCTGGAGCCAAGATGGACCCAGG - Intronic
939334030 2:140802028-140802050 CCTTAAGCTCAGAGGGAACTGGG - Intronic
939678066 2:145096876-145096898 CCTAGAGCTCAGAGGTGAGCAGG - Intergenic
945355928 2:208839404-208839426 GGTAGAGAGCAGAGGGAACCTGG + Intronic
947723366 2:232382083-232382105 CCTACAGCCCAGTGGGTACCAGG + Exonic
947777122 2:232722081-232722103 CAGAGAGCCCACAGGAAACCAGG - Intronic
948840609 2:240647097-240647119 CCTGGAGCCAAGGGGGAGCCGGG - Intergenic
948858832 2:240743165-240743187 CCCAGAGGCCACAGGGAACCAGG + Intronic
948987856 2:241536336-241536358 CTCAGATCCCAGAGGGAACAGGG + Intergenic
1168955023 20:1828685-1828707 CCAGGAGCCCAGAGGGAAGCTGG + Intergenic
1170098407 20:12672098-12672120 CCTAGAGCCCAGAAATAATCAGG + Intergenic
1171248489 20:23632099-23632121 CCCACAGCCCACAGGGAAGCAGG - Intronic
1172123007 20:32609529-32609551 CCTAGAGCCCACGGGGAAGTTGG + Intergenic
1174665760 20:52256368-52256390 CTTAGAGGCCAGAGGGGACTCGG - Intergenic
1176177971 20:63737574-63737596 CCTAGAACCCAGAGGGCAGGAGG - Exonic
1177716045 21:24840599-24840621 CCGAGAGCCCAGAGCGAGCAAGG + Intergenic
1179669958 21:42939803-42939825 CCTAGAGGCCAGGGTGATCCTGG + Intergenic
1179961668 21:44770903-44770925 CATGGGGCCCACAGGGAACCAGG + Exonic
1181545593 22:23600336-23600358 CTCAGAGCTCAGAGGGACCCAGG - Intergenic
1181814714 22:25429563-25429585 CTCAGAGCTCAGAGGGACCCAGG + Intergenic
1183281603 22:36935474-36935496 CCGAGACCCCAGAGGGCACTGGG + Intronic
1184481900 22:44752810-44752832 TCTAGAACCCACAGGGGACCCGG - Intronic
1184515792 22:44961409-44961431 CCTAGAGCAGAGAGGGAAGGAGG - Intronic
1184656808 22:45946046-45946068 CCTAGAGCCCAGAGTCCCCCAGG - Intronic
949862489 3:8518859-8518881 CCTGGAAACCAGAGGAAACCAGG + Intronic
953217306 3:40931285-40931307 TGTAGAGCCCTGAGTGAACCAGG + Intergenic
953503447 3:43460196-43460218 CCTAGAACCCAGATGGAGGCAGG + Intronic
954047948 3:47949135-47949157 CCTAGAACCTAAATGGAACCTGG - Intronic
955393214 3:58536210-58536232 CCTAGAGCACCCAGGGAACGAGG - Intronic
960944373 3:122956254-122956276 CCCAGAACCCACAGGGAACTGGG - Intronic
961803618 3:129472234-129472256 CCTTGAGCCCAGGGGGATCAAGG - Intronic
962148243 3:132864539-132864561 CCTAAAGCACAGAGAGAACAGGG - Intergenic
962326027 3:134433011-134433033 CCTGGAGCCCTCAGGGAACCGGG + Intergenic
963390702 3:144660195-144660217 ACTAGAGGCCAGAGGAAAGCAGG + Intergenic
964719999 3:159761863-159761885 CCCAGAGCTCAGAGGGAGTCTGG + Intronic
967464887 3:189793145-189793167 CCTCGAGCCCAGAGGGAACTAGG + Intronic
967775046 3:193377675-193377697 CCCAGATCTCACAGGGAACCAGG + Intronic
968122361 3:196134615-196134637 CCCTGACCCCACAGGGAACCCGG - Intergenic
969262489 4:6042947-6042969 CCCAGACCCCAGAGGGAACGTGG - Intronic
969669889 4:8583783-8583805 TGAAGAGCTCAGAGGGAACCTGG - Intronic
971004402 4:22357285-22357307 CCCAAAGCCCAGAGAGGACCTGG + Intronic
973214043 4:47649021-47649043 CCTAGACCACAGTGGGAAGCAGG - Intronic
973702821 4:53553603-53553625 CCTAGACCCCAAAGGGAATCTGG - Intronic
976491205 4:85672641-85672663 ACCAGAGCCCAGCTGGAACCAGG - Intronic
978253044 4:106656406-106656428 CCTTGAACTCAGAGGCAACCTGG + Intergenic
978479886 4:109176907-109176929 CCTAGAGTTCAGAAGGAACATGG + Intronic
979219094 4:118200367-118200389 CCTTGAGCCTAAAGGGAACATGG - Intronic
979545305 4:121933230-121933252 GCTAGATCCCAGAAGGAAGCCGG + Intronic
981315165 4:143334768-143334790 TCTAAACCCCAGTGGGAACCAGG + Intergenic
985575394 5:671325-671347 CTTGGGGCCCAGAGGGACCCCGG + Intronic
985692873 5:1323295-1323317 CCCTGAGCCAAGAGGGATCCCGG - Intronic
985692892 5:1323353-1323375 CCCTGAGCCAAGAGGGATCCCGG - Intronic
986072951 5:4305136-4305158 CCTAGAGCCCAAAGAGGAACAGG + Intergenic
997232422 5:132254488-132254510 CCTAGAGACCTGAGGCCACCAGG + Intronic
999379589 5:151110767-151110789 CCAAGAGACCTGAGAGAACCCGG + Intronic
1003336903 6:5181840-5181862 CCTAGAGCTCAGAGGCCATCTGG - Intronic
1004503580 6:16229778-16229800 CCAAGACCCCAGGGGGGACCCGG - Intergenic
1005894073 6:30163366-30163388 CCTAGGGACCAGAAGGAGCCAGG + Exonic
1018307956 6:162478037-162478059 CCTAGAGCACAGGGCGAACATGG + Intronic
1019421522 7:953383-953405 CCTCCATCCCAGAGGGAATCAGG + Intronic
1019433543 7:1010615-1010637 CCTGCAGCCCAGGGGGAGCCAGG - Intronic
1022414132 7:30163730-30163752 GCTAGTGCCCAAAGGGAACTCGG - Intergenic
1025846180 7:65200295-65200317 CCTAGAGCCCAGAAGGAAGCTGG + Intergenic
1027661977 7:80998075-80998097 TCAAGAGCCCAGATGGAGCCTGG - Intergenic
1029438211 7:100574101-100574123 CCTCGACCCCAGAGGCAGCCAGG + Intronic
1034354851 7:150444040-150444062 CCTAGACTCCAGAGGGACCCTGG + Intergenic
1034437157 7:151068151-151068173 CCCAGAGCCCAGAGGAAGCATGG + Intronic
1036284307 8:7430356-7430378 CCTGGAGTCCAGAGAGCACCCGG - Intergenic
1036337169 8:7881174-7881196 CCTGGAGTCCAGAGAGCACCCGG + Intergenic
1036421619 8:8601148-8601170 CATACAGCTCAGAGGGAATCAGG - Intergenic
1039895588 8:41714418-41714440 CCCAGAGCCCTGTGGGAACAGGG + Intronic
1041467572 8:58172567-58172589 CCTATATCCCTGAGGGAAGCAGG + Intronic
1047183005 8:122606939-122606961 CCAAGAGCCCAGAGAGCAACTGG + Intergenic
1047747006 8:127852776-127852798 CCTAGAGAACAGCGGGTACCAGG - Intergenic
1048291450 8:133184712-133184734 CCTAGAGGCCAGAGGGGCCGAGG - Intergenic
1049340861 8:142111982-142112004 CCTAGAGCGCAGAGGCTGCCTGG - Intergenic
1051392679 9:16582624-16582646 CCTGGACCTCAGAGGGAAGCTGG - Intronic
1052815532 9:33100131-33100153 CCAAGAGGCCAAAGGGAACTAGG - Intergenic
1053249025 9:36559085-36559107 CATGGAGCCCAGAGGGAAAAAGG - Intergenic
1058038001 9:100273931-100273953 GCTAGAGCCCAGAGAGAAAATGG + Intronic
1059948423 9:119437043-119437065 CATAGGGCCCAGAGCCAACCTGG - Intergenic
1060310057 9:122451830-122451852 CCCCCAGACCAGAGGGAACCTGG - Intergenic
1061297674 9:129685846-129685868 CTGAGGGCGCAGAGGGAACCCGG + Intronic
1061761935 9:132857425-132857447 CCTGGAGACCTGAGGGAAACGGG - Intronic
1061829437 9:133281547-133281569 ACGAGAGCCCAGAGGGAAAGTGG - Intergenic
1062287709 9:135780495-135780517 CCAAGAGCCCATAGGGATCCTGG + Intronic
1062465653 9:136679865-136679887 GCCAGAGCCCTGAGGAAACCTGG + Intronic
1187410671 X:19048152-19048174 CATAAAGCCCTGAGAGAACCAGG - Intronic
1191696556 X:63996475-63996497 CCTAGACAGCAGAGGGACCCTGG - Intergenic
1192196574 X:69032743-69032765 CCCAGAGCCCAGAGCACACCTGG - Intergenic
1192554288 X:72077716-72077738 CCTCCAGCCCAGAGGGATCCGGG + Intergenic
1195378402 X:104249647-104249669 CACAGAGCCCTGAGGGAACGGGG - Intergenic
1196339869 X:114583861-114583883 CCTAGAGAGTAGGGGGAACCAGG - Intergenic
1198223576 X:134625186-134625208 CCTGGAGCCCAGCTGCAACCTGG - Intronic
1199148265 X:144397238-144397260 ACCATAGGCCAGAGGGAACCTGG + Intergenic
1199591236 X:149470007-149470029 CCCAGGTCCCAGAGTGAACCTGG - Intergenic
1201148240 Y:11078447-11078469 CCCAGAGCCCAGCAGAAACCAGG + Intergenic