ID: 1110710400

View in Genome Browser
Species Human (GRCh38)
Location 13:78644573-78644595
Sequence GAACTCTCTGGGCTTTTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 225}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110710390_1110710400 29 Left 1110710390 13:78644521-78644543 CCACCTACTTTATGAAGCCCTTC 0: 1
1: 0
2: 4
3: 24
4: 252
Right 1110710400 13:78644573-78644595 GAACTCTCTGGGCTTTTTTGGGG 0: 1
1: 0
2: 0
3: 21
4: 225
1110710394_1110710400 11 Left 1110710394 13:78644539-78644561 CCTTCTCGGTGTTCTTAGCTGAA 0: 1
1: 0
2: 0
3: 15
4: 125
Right 1110710400 13:78644573-78644595 GAACTCTCTGGGCTTTTTTGGGG 0: 1
1: 0
2: 0
3: 21
4: 225
1110710393_1110710400 12 Left 1110710393 13:78644538-78644560 CCCTTCTCGGTGTTCTTAGCTGA 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1110710400 13:78644573-78644595 GAACTCTCTGGGCTTTTTTGGGG 0: 1
1: 0
2: 0
3: 21
4: 225
1110710391_1110710400 26 Left 1110710391 13:78644524-78644546 CCTACTTTATGAAGCCCTTCTCG 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1110710400 13:78644573-78644595 GAACTCTCTGGGCTTTTTTGGGG 0: 1
1: 0
2: 0
3: 21
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110710400 Original CRISPR GAACTCTCTGGGCTTTTTTG GGG Intronic
901687654 1:10952498-10952520 TAATTCTCTGGGCATTTTTTTGG + Intronic
902177190 1:14659387-14659409 GGACACTCTGGGGTTTTATGGGG + Intronic
902323318 1:15683566-15683588 GGAGTCTCTGGGGTTTTGTGGGG + Intergenic
903336672 1:22629038-22629060 GTCCTCTCTGGGGTGTTTTGAGG - Intergenic
903464981 1:23545784-23545806 GAACTCTCTGAGCATTTTCTTGG - Intergenic
904969687 1:34409494-34409516 GGACTATCTAGGCTGTTTTGTGG + Intergenic
906608855 1:47188711-47188733 GAACTCTCTGGCCTGTAGTGAGG + Intronic
906660659 1:47579103-47579125 GAACTCTCTGGTTTTGTTCGGGG + Intergenic
907697730 1:56750736-56750758 GACCTCACAGGGCTTTTATGAGG - Intronic
910257159 1:85259594-85259616 GGACCCTCTGAGCTATTTTGCGG - Exonic
912277877 1:108279775-108279797 GAACTCCCTTAGCTTTTTTCTGG + Intergenic
912290349 1:108414584-108414606 GAACTCCCTTAGCTTTTTTCTGG - Intronic
913088283 1:115458876-115458898 CAACTCCCTGGGCTGTTATGCGG - Intergenic
915214801 1:154332803-154332825 CAACTCCCTGGACTGTTTTGGGG + Intronic
915822955 1:159044984-159045006 CAACTCTTAGGGCTATTTTGGGG - Intronic
915823315 1:159049119-159049141 CAACTCTTAGGGCTATTTTGGGG - Intronic
916803356 1:168234884-168234906 TAACTCTGTGGGCTTTGGTGTGG + Intronic
918050242 1:180967290-180967312 CAGCTCTCTGGTCTTTTTTGAGG + Intergenic
918152941 1:181814229-181814251 GAAATCTTTGTGCTTTTCTGTGG - Intergenic
918416097 1:184310242-184310264 CCACTGTCTGGGCTTATTTGTGG + Intergenic
918985289 1:191617246-191617268 GATCTCTCTGGGCTTTGGTCAGG + Intergenic
919718714 1:200809342-200809364 GAACTTTCTTCCCTTTTTTGTGG + Intronic
920928089 1:210361728-210361750 GTACTCTTTGTCCTTTTTTGGGG + Intronic
921105559 1:211973665-211973687 ATACTCTCAGGGTTTTTTTGAGG - Intronic
921730185 1:218569434-218569456 GAATTCTCTGGGGTGTATTGAGG - Intergenic
922655071 1:227374903-227374925 GAACTCTCCAGGCTTTCCTGTGG + Intergenic
924583724 1:245343973-245343995 AGAATCTCTGGGCTTTCTTGGGG + Intronic
924761061 1:246986597-246986619 GAACACTCTGGTGTTTTCTGAGG + Exonic
1064101506 10:12468457-12468479 GAACTTTCTGGGCATTTGTTGGG + Intronic
1064219288 10:13426331-13426353 GAACTATTTGGGCTCTTTTTTGG - Intergenic
1066476336 10:35750666-35750688 GAACTCTTTGGGGTTTTCAGTGG + Intergenic
1067943017 10:50671836-50671858 GCACTCTCTGGGCTGTTCTCTGG - Intergenic
1068341798 10:55713931-55713953 CAACTCTCTGAGCTTTTTCATGG + Intergenic
1070707801 10:78654075-78654097 GAAGACTCTGGGCTTCCTTGAGG + Intergenic
1070895928 10:79982902-79982924 GACCACTCTGGGCTTTGGTGTGG - Intergenic
1071724926 10:88188881-88188903 GAAATCTCTGTGCTTTTTGTAGG + Intergenic
1072173197 10:92887780-92887802 GAACTTTCTAGGCTTTTTCTAGG + Intronic
1072322301 10:94262627-94262649 CACATCTCTGGGCATTTTTGGGG + Exonic
1075613055 10:123868827-123868849 GAGTCCTCTGGGCTTATTTGCGG - Intronic
1078658206 11:13261895-13261917 GAACTATCTTGTCTTTTTTTAGG - Intergenic
1080375737 11:31708265-31708287 GAACTCTGATGGCTTTGTTGTGG - Intronic
1080491800 11:32772874-32772896 GAACTACCTGGGCTGTTTTCTGG - Intronic
1081581422 11:44354901-44354923 GAACACTCTGGGCTGTTTTCTGG + Intergenic
1081622512 11:44627121-44627143 CAACTCTCAGGGCTATTGTGAGG - Intergenic
1082092575 11:48101852-48101874 AAACTCTCTGCTCTTTTTTGGGG + Intronic
1083661244 11:64252578-64252600 GAAGACTCTGGGCTCTTTTCCGG + Intronic
1084589364 11:70081314-70081336 GGAGTGTCTGGGCTTGTTTGGGG - Intronic
1086844947 11:91737398-91737420 TGACTCTTTGGGCTCTTTTGTGG - Intergenic
1089427144 11:118387692-118387714 GACTTCTCTGGGCTATTTTAGGG - Intronic
1098201507 12:68061107-68061129 AATCTGTCTGGGCTTTTTTTTGG + Intergenic
1098705735 12:73686011-73686033 TCACTGTCTGGGCTTATTTGTGG - Intergenic
1098733765 12:74070663-74070685 GGACTATATGGGCTTTTTTTTGG - Intergenic
1099294286 12:80810634-80810656 GAATTCTATGAACTTTTTTGAGG + Intronic
1101424940 12:104580306-104580328 GAACGCTTTTGGCTTTATTGTGG - Intronic
1103853957 12:123951696-123951718 GACCTCTGGGGGCTTTTCTGTGG + Intronic
1104519790 12:129462975-129462997 GAAATCTCTGGAGTTTATTGTGG - Intronic
1104618983 12:130295533-130295555 GGACTCTATTGGTTTTTTTGTGG - Intergenic
1106912281 13:34475699-34475721 GAAGTCTTTGGGCTTTGTTCAGG - Intergenic
1109618264 13:64865365-64865387 TTACTCTCTAGGCTGTTTTGTGG + Intergenic
1110710400 13:78644573-78644595 GAACTCTCTGGGCTTTTTTGGGG + Intronic
1111182837 13:84691392-84691414 GAACACACTGAGCTTTTTTAAGG + Intergenic
1111561782 13:89960021-89960043 GAAGTCTCTAGGGTTTTCTGGGG + Intergenic
1111665500 13:91262914-91262936 GGACTATCTGGGCTCTTTTTTGG + Intergenic
1115385553 14:32792093-32792115 GGACTCTGTGGGCTCTTTTTTGG + Intronic
1116631056 14:47334140-47334162 AAACCTTCTTGGCTTTTTTGTGG + Intronic
1118328842 14:64800463-64800485 GAACCCTCCAGGCTTTTATGTGG - Intronic
1121947249 14:98135363-98135385 GCACTCTCTGGGGTTTTTAAGGG + Intergenic
1124492077 15:30164245-30164267 GCACTCCCTTGGCATTTTTGTGG + Intergenic
1124751460 15:32374072-32374094 GCACTCCCTTGGCATTTTTGTGG - Intergenic
1125752868 15:42041968-42041990 GAATTCTCTGGGCTATTTGGAGG + Intronic
1126733826 15:51711845-51711867 GTAGTCTCTGTGCTTCTTTGGGG + Intronic
1127383050 15:58445786-58445808 GACCCCACTGGGCTGTTTTGAGG + Intronic
1129778087 15:78250004-78250026 GGATTCTCTGGCCTTTTGTGTGG + Intergenic
1130401635 15:83560615-83560637 TAACTCACTGGGGTTTTTGGAGG - Intronic
1131263851 15:90904110-90904132 GAACTCACTGGGGTATTTGGTGG + Intronic
1133008256 16:2896544-2896566 GAACTTTCTGGGCTTCCTGGGGG - Exonic
1133013822 16:2929780-2929802 GAACTCCCTGGGCTTCCTGGGGG - Exonic
1133733051 16:8592237-8592259 GATCTCACTGGGCTTCTCTGAGG + Intergenic
1133828962 16:9304280-9304302 GAACTGTTTGGTCATTTTTGTGG - Intergenic
1134587610 16:15425570-15425592 GAATTGTCTGAGTTTTTTTGTGG - Intronic
1140198997 16:72879359-72879381 GATCTCCCTGGGCTTGTGTGTGG - Intronic
1140631296 16:76855557-76855579 GGACTCTCTGCTCTTTTGTGTGG + Intergenic
1140789967 16:78382114-78382136 TACCTCTCTGGGCTTGTTTCAGG - Intronic
1143325869 17:6097926-6097948 GAACTCTCTGGGCCCTAATGAGG - Intronic
1144519182 17:15943009-15943031 GATCTCTCTGGCCTTCTGTGTGG + Intergenic
1149006278 17:51809673-51809695 GACCTCACTGGGCTTTATAGTGG + Intronic
1151603083 17:75118585-75118607 CAAGTCTCTGGCCTCTTTTGTGG + Intronic
1152113453 17:78370181-78370203 GAACGTCCTGGGCTTCTTTGTGG + Intergenic
1152995044 18:398805-398827 AAAATCTCCGGGCTTTTCTGGGG + Intronic
1154477347 18:14775645-14775667 GAACTCTTTGAGTTTCTTTGTGG + Intronic
1158580976 18:58682541-58682563 GAACCCTCTGGGTTTTGCTGGGG - Intronic
1159600797 18:70426970-70426992 GAACGCTCTGAGCTGCTTTGAGG + Intergenic
1161551443 19:4915069-4915091 GAAGTCTCTGGGAATATTTGTGG - Intronic
1161617722 19:5281474-5281496 GAACTCTGTGATCTTTTTTGTGG - Intronic
1163009134 19:14413737-14413759 GAACCCACTGGGCTTTCATGGGG + Intronic
1164097310 19:22023076-22023098 GATATCTCTGGCCTTTTATGAGG - Intergenic
1164117501 19:22236511-22236533 GAGATCTCTGGCCTTTTATGGGG - Intergenic
1166124239 19:40704090-40704112 GGACTCCCTGGGCTGTTGTGGGG + Intronic
1168585833 19:57590990-57591012 GAACTCTCTGGTGTTTAATGAGG - Exonic
925071626 2:973488-973510 GGATTCTCTGGGCTTCTTGGGGG + Intronic
926070759 2:9888125-9888147 TACCTCTCTGTGTTTTTTTGTGG + Intronic
926796604 2:16624846-16624868 TATCTCACTGGGATTTTTTGAGG - Intronic
927097000 2:19754938-19754960 AGGCTCTCTGGGCTTTTGTGAGG - Intergenic
928346985 2:30508738-30508760 GAGCTCTTTGGGCTCTTTTTTGG + Intronic
933167363 2:79091201-79091223 AAACTCTCTAAGCTTTATTGAGG - Intergenic
935812587 2:106813915-106813937 GAACTCTAGGAGCTGTTTTGTGG + Intronic
935881406 2:107569442-107569464 TTACTCTCTGGGCTTTTGTGGGG - Intergenic
937047926 2:118862007-118862029 GAAACCTCTGGGCCTTTTAGGGG + Intergenic
939688165 2:145224890-145224912 CAACTCACTGAGCTTTTATGAGG + Intergenic
942439900 2:176021774-176021796 GAGCTCTGTAGACTTTTTTGTGG + Intergenic
946525596 2:220515890-220515912 TAAATCTCTGTGCATTTTTGGGG + Intergenic
948093123 2:235312445-235312467 GAAGGCACTTGGCTTTTTTGGGG + Intergenic
1169673964 20:8133214-8133236 GAACCCTCTTGGCGCTTTTGTGG + Intronic
1173410854 20:42808338-42808360 GCTCTGTCTGGGCATTTTTGAGG + Intronic
1176144609 20:63559985-63560007 GAAGTTTCTGGGCTTCGTTGTGG - Exonic
1179182773 21:39059893-39059915 GAAGACTTTGGGCTGTTTTGGGG + Intergenic
1179808767 21:43856829-43856851 TAACTCACTGGGCTTTTTTCTGG + Intergenic
1182634427 22:31713146-31713168 GAAGTCTGTGCGCTTTTGTGGGG + Exonic
1183241460 22:36660769-36660791 GAAGGCTCTGGGCTGTTATGGGG - Intronic
1184346809 22:43918583-43918605 GAACTCCCTGGGTTTTATTCTGG + Intergenic
950226137 3:11235957-11235979 GAATTCCCTGGGCTTTTTTTTGG - Intronic
950880448 3:16318743-16318765 GAACTCATTTGGGTTTTTTGGGG - Intronic
955317501 3:57951142-57951164 TGACTCCCTTGGCTTTTTTGAGG - Intergenic
956592629 3:70931335-70931357 GAATTTTATGGGCATTTTTGAGG + Intergenic
958223304 3:90775452-90775474 TAAATCTTTGGACTTTTTTGAGG + Intergenic
958224346 3:90793291-90793313 TAAATCTTTGGACTTTTTTGAGG + Intergenic
958224451 3:90794991-90795013 TAAATCTTTGGACTTTTTTGAGG + Intergenic
958225171 3:90806883-90806905 TAAATCTTTGGACTTTTTTGAGG + Intergenic
958225775 3:90817080-90817102 TAAATCTTTGGACTTTTTTGAGG + Intergenic
958227390 3:90844267-90844289 TAAATCTTTGGACTTTTTTGAGG + Intergenic
958233917 3:90953856-90953878 TAAATCTTTGGACTTTTTTGAGG + Intergenic
958234800 3:90968806-90968828 TAAATCTTTGGACTTTTTTGAGG + Intergenic
958240062 3:91057491-91057513 TAAATCTTTGGACTTTTTTGAGG + Intergenic
958247298 3:91178985-91179007 TAAATCTTTGGACTTTTTTGAGG + Intergenic
958247403 3:91180684-91180706 TAAATTTTTGGGCTTTTTTGAGG + Intergenic
958250741 3:91236344-91236366 TAAATCTTTGGACTTTTTTGAGG + Intergenic
958251032 3:91240934-91240956 TAAATCTTTGGACTTTTTTGAGG + Intergenic
958251171 3:91243312-91243334 TAAATCTTTGGACTTTTTTGAGG + Intergenic
959416119 3:106077921-106077943 GAATTTTCTGTGCTTTTTTGAGG + Intergenic
959766038 3:110029645-110029667 TAACTCTCATGGGTTTTTTGTGG + Intergenic
960159411 3:114333788-114333810 GAAATCTCTGGGCTTTTCCATGG - Intergenic
961635447 3:128330040-128330062 GACATCCCTGGGCTTTTTAGGGG - Intronic
962429626 3:135307245-135307267 GAAATCTCTGGTCTTTTCTCAGG + Intergenic
963031120 3:140977868-140977890 GCACTTTGTGGCCTTTTTTGGGG + Intronic
963359069 3:144247175-144247197 TAACTCTCTGGGCTATTATCTGG - Intergenic
965371308 3:167865047-167865069 GATTTCTGTGGGCTTCTTTGAGG + Intergenic
965571918 3:170181607-170181629 GAAAGCTCAGGGCTCTTTTGCGG - Intronic
967562268 3:190930354-190930376 TAACTTTCTGGGTTTTTTTGAGG + Intergenic
967744403 3:193038981-193039003 GAACTTTCAGGGTTTTTTTTGGG - Intergenic
967952552 3:194852323-194852345 GAGCTCTCTGGGCTTTGTCAGGG + Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
969855780 4:9998404-9998426 GACCTCTCAGGGCTGTTGTGAGG + Intronic
970398028 4:15690691-15690713 TAAGTCTCTAGGCTTTTATGGGG - Intronic
970824958 4:20260144-20260166 GAACTCTCTGGGTAGTTTTGGGG - Intronic
971846926 4:31930871-31930893 GAACTCTTTGGCCTTTTTCATGG + Intergenic
972913973 4:43853151-43853173 GAAGTGTGTGGGCTCTTTTGAGG + Intergenic
973902887 4:55495672-55495694 GAACTCACTGGCCAGTTTTGGGG - Intronic
975925459 4:79445640-79445662 GAAGTCTCTGGGCTGTAATGAGG + Intergenic
975966406 4:79977669-79977691 ATGCTCTCTGGGCTTTGTTGAGG - Exonic
976235681 4:82894065-82894087 GAACTCTCTGGTCTTTCTCGGGG + Intronic
977208726 4:94193615-94193637 AAACTCTTTGGGTTTTTTTGTGG + Intergenic
977228407 4:94422300-94422322 GATCTCTCTGGGCTCTGTTTGGG - Intergenic
978417685 4:108494270-108494292 GAACTCCCTCAGCTTTTTTTTGG - Intergenic
978640830 4:110869340-110869362 AAATTCTCTGTTCTTTTTTGTGG + Intergenic
979395943 4:120189122-120189144 GACCTCACTGTGTTTTTTTGAGG + Intergenic
979496164 4:121385282-121385304 GAAATCTCAGGGCTTTCTTAAGG + Intergenic
981106169 4:140884480-140884502 GATCTCTCAGGCCTTTTCTGAGG + Intronic
985546207 5:510431-510453 GACCTCACTGGGCTTTACTGTGG + Intronic
985776828 5:1848700-1848722 GAACTCTTTGGGCCCTTCTGAGG - Intergenic
986570382 5:9157836-9157858 GAAATCTATGGGGTTTTTCGGGG - Intronic
987832536 5:23114779-23114801 GAACTCTCAGGGAGTTTTTGAGG + Intergenic
991023338 5:62004173-62004195 AAACTCTCTAGCCTTCTTTGGGG + Intergenic
991625694 5:68598513-68598535 GAACTCTCTGAACCTTTTTACGG + Intergenic
992379611 5:76224167-76224189 GAAGGCACTGGGATTTTTTGGGG + Intronic
994959662 5:106583013-106583035 AGACTCTCTGGGCTTTCTTTAGG + Intergenic
995637835 5:114215449-114215471 GAACCCTTTGAGCTTGTTTGTGG + Intergenic
996137273 5:119859372-119859394 GAACTCTCTCAGCTTTTTTTTGG + Intergenic
996440911 5:123489415-123489437 AATCTCACTGGGCTTTTGTGGGG + Intergenic
996538049 5:124599116-124599138 TACCTTTCAGGGCTTTTTTGAGG + Intergenic
996777655 5:127150173-127150195 GAACTCTCTGGGTTTGGTGGTGG + Intergenic
996801636 5:127409927-127409949 TAATTCTCTTGGCTTTTATGTGG - Intronic
997382700 5:133449106-133449128 GAACACTCAGCGCTTGTTTGGGG - Intronic
998867300 5:146518321-146518343 GAACTTTCTCCGCTCTTTTGGGG + Intergenic
998906413 5:146909869-146909891 AATCTGTTTGGGCTTTTTTGTGG - Intronic
999188306 5:149729219-149729241 GAACTCATTGGAGTTTTTTGGGG + Intergenic
999549066 5:152664063-152664085 GAACTCTCTCAGCTTTTGTTTGG - Intergenic
999600577 5:153259053-153259075 AAACTCTGTGGGCTGTTCTGAGG + Intergenic
1000213458 5:159131555-159131577 GATCTCTCTGGACTTTTTTTTGG + Intergenic
1000567917 5:162873976-162873998 GAACTCTCTGTCCTTTATTTTGG + Intergenic
1001864723 5:175093374-175093396 AAACTCTGTGGGCTTTGTTAAGG + Intergenic
1005556102 6:26985530-26985552 GAAATCTCATGGCTATTTTGTGG - Intergenic
1007829162 6:44625064-44625086 GGACTCTCTGGGCCTTTGTCGGG + Intergenic
1009937125 6:70246938-70246960 TATCTCTTAGGGCTTTTTTGAGG + Intronic
1012521347 6:100124783-100124805 AAACTCCCTGGACTCTTTTGGGG - Intergenic
1012710565 6:102598075-102598097 GAACTCTCTGCACTTTTATTTGG + Intergenic
1013948315 6:115749490-115749512 CTACTCTCTGTGCTTTTTTTTGG - Intergenic
1014339117 6:120180727-120180749 GAATTTTCTGTGCTTTTATGTGG - Intergenic
1014971491 6:127821251-127821273 GTACTCTTTGGTCTTTTTTGGGG - Intronic
1018667614 6:166153887-166153909 CAATTCTCTGGGCATTTTTTAGG - Intergenic
1021417943 7:20409768-20409790 GAATTCACTGACCTTTTTTGAGG - Exonic
1021460039 7:20876089-20876111 GAACTTGCTGGGGTTTTTTTGGG + Intergenic
1022149262 7:27582929-27582951 GACCTCACAGGGCTTTTGTGAGG + Intronic
1023103762 7:36744655-36744677 GAAGTCTTTGGGTTTTTTGGTGG + Intergenic
1024289448 7:47791164-47791186 AAATTTTCTGGGCTTTTTTAGGG + Intronic
1027785727 7:82576805-82576827 GAGCTCTTTGGGCTTTTCTGGGG - Intergenic
1029676293 7:102071381-102071403 GAACTCTCTGGTCCTGTTTGTGG + Intronic
1030370350 7:108693263-108693285 GTACTGTCTGGGCTTATTTGTGG + Intergenic
1031452141 7:121935417-121935439 GAACTGTCTGGGCTTTGTGTAGG + Intronic
1034079819 7:148266252-148266274 GAGCTTTCTGGGCCTTTTTTGGG - Intronic
1034286226 7:149884998-149885020 TAATTCTTTGGGTTTTTTTGTGG + Intergenic
1039768794 8:40661714-40661736 AAAAGCTGTGGGCTTTTTTGTGG - Intronic
1040434298 8:47375062-47375084 TAAATGTCTGGGGTTTTTTGGGG - Intronic
1040478441 8:47802014-47802036 TAATTATATGGGCTTTTTTGAGG - Intronic
1041231150 8:55753671-55753693 CAACTCTCTTGGCTTGTTTCTGG + Intronic
1045255096 8:100512944-100512966 GAGATCTCTGGGCTCTATTGAGG + Intronic
1046112006 8:109736732-109736754 GAATTCTCTGAGTTTTTTTAGGG - Intergenic
1046755591 8:117969999-117970021 AAATTCTCATGGCTTTTTTGTGG - Intronic
1048032259 8:130643753-130643775 GAAATATATGTGCTTTTTTGAGG + Intergenic
1048175312 8:132147041-132147063 GAACACAATGGGCTTTTTGGTGG + Intronic
1049051616 8:140201507-140201529 GAACTCTATGAGCTGTTTTCTGG - Intronic
1050467596 9:5946169-5946191 GAACTGTCTTGCCATTTTTGTGG - Intronic
1053243621 9:36516763-36516785 GAGCTTTATGTGCTTTTTTGTGG - Intergenic
1055416683 9:76091608-76091630 GATCTCTCTGGGTTTTAATGAGG + Intronic
1057912702 9:99032533-99032555 GTACTCTATGGACTTTTTTTGGG + Intronic
1059015840 9:110514681-110514703 GAAATGTCTGGGCTGATTTGTGG + Intronic
1059040621 9:110811893-110811915 GAGCTCTCTGGGTTTTCTTTGGG + Intergenic
1059055168 9:110971738-110971760 TTCCTCTCTTGGCTTTTTTGTGG - Intronic
1060169877 9:121452816-121452838 GCCCTCTCAGGGCTATTTTGGGG + Intergenic
1060787712 9:126463711-126463733 CAATTCTCTGGGCTCTCTTGAGG + Intronic
1060908954 9:127333586-127333608 GGCTTCTCTGAGCTTTTTTGAGG + Intronic
1185871031 X:3665000-3665022 GATCCCTCTGGGGTATTTTGAGG - Intronic
1185937793 X:4278544-4278566 GAATTCTTAGTGCTTTTTTGTGG + Intergenic
1186826057 X:13341111-13341133 GAATGCTTTGGGTTTTTTTGGGG + Intergenic
1187237537 X:17482267-17482289 GACATCTCAGGGCTTTTTTAGGG + Intronic
1190249722 X:48713298-48713320 GAGTTCACTGGGCTGTTTTGCGG - Intergenic
1191717540 X:64204093-64204115 GGGCTCTCTAGGCCTTTTTGAGG - Intronic
1192163660 X:68808890-68808912 GGCCTCTCTGGGATTCTTTGGGG + Intergenic
1192911724 X:75611848-75611870 GAGCTCTATGGGCTATGTTGAGG + Intergenic
1193590537 X:83384100-83384122 GGACTCCCTGGGCTTTCTTGGGG - Intergenic
1196043845 X:111235017-111235039 GAACTCACAGGGCTTTTAGGTGG - Intergenic
1196051253 X:111307703-111307725 GAACTCCCTGGGTATTTTTCAGG + Intronic
1196493808 X:116299924-116299946 AACCTCTTTGGGCTTTTCTGAGG - Intergenic
1197760517 X:130024768-130024790 GACCTCACAGGGCTGTTTTGAGG - Intronic
1198929249 X:141836225-141836247 TAGTTCTGTGGGCTTTTTTGAGG + Intergenic
1200793057 Y:7316512-7316534 GATCCCTCTGGGGTATTTTGAGG + Intergenic
1201231950 Y:11873518-11873540 CATCTCTCTGTGCTTTTTTTGGG - Intergenic
1201721319 Y:17100643-17100665 GAATTCTTAGTGCTTTTTTGTGG + Intergenic