ID: 1110711176

View in Genome Browser
Species Human (GRCh38)
Location 13:78652816-78652838
Sequence CGCCTTCTGCTGTGCAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 177}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110711176 Original CRISPR CGCCTTCTGCTGTGCAGTCC TGG Intronic
900866863 1:5275162-5275184 CGCCACCTGCGGTGCAGCCCTGG + Intergenic
901002960 1:6157754-6157776 CACCTGCTGCTCTGCTGTCCTGG - Intronic
902098446 1:13965700-13965722 CGACTTCTGCTGTGAAGTCAAGG + Intergenic
902513821 1:16979691-16979713 CGCCTTCTGCTGAGCAGCGGGGG - Intronic
903450055 1:23447120-23447142 CACCTCCTGCTGTTCAGTCCAGG + Intronic
904405409 1:30285207-30285229 CCCCCTCCACTGTGCAGTCCCGG + Intergenic
904909562 1:33923793-33923815 CACCTCCTGCTGTGCAGCCCAGG - Intronic
907552747 1:55318243-55318265 CGCCTTCAGACTTGCAGTCCTGG + Intergenic
909642409 1:77883421-77883443 CACCTCCTGCTGTGCAGCCTGGG + Intergenic
911903094 1:103529833-103529855 CACCTCCTGCTGTGCGGCCCAGG - Intronic
915655331 1:157354543-157354565 GGCCTTGTGCTCTGCAGTACAGG - Intergenic
916654278 1:166859664-166859686 GGCCTCCTGCTGTGCAGACATGG - Intronic
918674380 1:187264018-187264040 ATCCTTCTGCTGTCCAGTCTTGG - Intergenic
924428839 1:243979330-243979352 CAGCTTCTGCTGTACAGTGCGGG + Intergenic
1063254536 10:4311645-4311667 CGCCTTCTGCAGTTCCATCCTGG - Intergenic
1076461870 10:130653329-130653351 GGGCCTCTGCTGTGCAGTCAGGG + Intergenic
1077409341 11:2396157-2396179 CGCCCTGTGCTGCGCATTCCGGG + Intronic
1077844934 11:6013582-6013604 CCCACTCAGCTGTGCAGTCCAGG + Intergenic
1078147649 11:8732784-8732806 GGCCTTGTGCTGTGCAGTGTTGG - Intronic
1079085921 11:17444783-17444805 AGCCTTTTGCTGTGCAGTCTTGG + Intronic
1079451830 11:20604778-20604800 AGCCAGCAGCTGTGCAGTCCTGG + Intronic
1080873751 11:36258898-36258920 CGCCATCAGCTGCCCAGTCCCGG - Intergenic
1083339827 11:61951861-61951883 CGCCTGCTGCTGTGCTGGCGGGG + Intronic
1084476657 11:69393354-69393376 CGTCATGTGCTGTGCAGCCCTGG + Intergenic
1084768834 11:71329685-71329707 CACCTCCTGCTGTGCAGCCAGGG + Intergenic
1084993598 11:72953732-72953754 CGCCTTATGTTGTGTAGTCAGGG + Intronic
1085045840 11:73352969-73352991 CACCTTCTGCTGGGCATGCCAGG - Exonic
1086804035 11:91217251-91217273 CACCTCCTACTGTGCAGCCCAGG + Intergenic
1087192665 11:95271872-95271894 TGCCTTGTGCTGTGTAGACCTGG + Intergenic
1089138241 11:116266467-116266489 CCCTTTCTGCCGTGCAGCCCTGG - Intergenic
1089158586 11:116421047-116421069 CAGCTCCTGCTGTGCAGCCCGGG + Intergenic
1089716144 11:120361189-120361211 CACCTCCTGCTGTGCAGCCCTGG - Intronic
1090880277 11:130826711-130826733 CGCTTTCTGCTGTGCCCTGCAGG - Intergenic
1091066208 11:132515496-132515518 AGCCTTCAGCTGTGAAGCCCAGG + Intronic
1091936047 12:4435200-4435222 CACCTCCTGCTGTACAGCCCAGG - Intronic
1091938155 12:4449994-4450016 CACCTCCTGCTGGGCAGCCCGGG + Intergenic
1094167425 12:27456833-27456855 CACCTCCTGCTGTGCGGCCCAGG - Intergenic
1094546873 12:31412605-31412627 CATCTCCTGCTGTGCAGCCCTGG + Intronic
1095743724 12:45634685-45634707 CGCCTTGTGCTCAGCAGCCCTGG + Intergenic
1096878957 12:54651835-54651857 AGACTTCAGCTGTGCAGTGCAGG + Intergenic
1098937096 12:76492481-76492503 CACCTCCTGCTGTGTGGTCCAGG - Intronic
1099325306 12:81207758-81207780 CTCATTCTTCTGTGCTGTCCTGG + Intronic
1101899623 12:108781780-108781802 TGCTTTCTGCTGTGTAGTCAGGG - Intergenic
1103881492 12:124169610-124169632 CATCTTCTGCTTTGCAGACCTGG + Intronic
1106109497 13:26763958-26763980 CACCATGTGCTGTGCAGTACTGG - Intergenic
1107874495 13:44778176-44778198 CACCTCCTGCTGTGCAAGCCAGG + Intergenic
1109737255 13:66503028-66503050 GTCATTCTGCTGAGCAGTCCAGG + Intronic
1110711176 13:78652816-78652838 CGCCTTCTGCTGTGCAGTCCTGG + Intronic
1113900687 13:113795189-113795211 CGCCTTCTGCTGCGCCATCGTGG + Exonic
1114036753 14:18636503-18636525 CTCCTGCTGCCCTGCAGTCCCGG + Intergenic
1114121883 14:19678534-19678556 CTCCTGCTGCCCTGCAGTCCCGG - Intergenic
1117554412 14:56869854-56869876 CACCTCCTGCTGTGCGGCCCAGG - Intergenic
1117878805 14:60285722-60285744 CACCTTCTACTCTGCATTCCAGG - Exonic
1119194222 14:72705090-72705112 CACATCCTGCTGTGCAGTCCAGG - Intronic
1119626233 14:76178781-76178803 CACCTCCTGCTGTGCGGCCCCGG + Intronic
1122782540 14:104149744-104149766 TGCCTCCTGCTGTGCAGCCCTGG + Intronic
1122893126 14:104742136-104742158 CGCTTCCTGCCGTGCAGGCCAGG + Intronic
1125835568 15:42747648-42747670 TGCCTCCTGCCGTGCAGCCCTGG + Intronic
1125862187 15:43009356-43009378 CGCCAGCTGCTGTGCAGGGCAGG - Intronic
1128094319 15:64942405-64942427 AGCCTGCAGCTGGGCAGTCCTGG + Intronic
1128130900 15:65226426-65226448 CCCCTTCTGCTGGGCAGGCTAGG + Intergenic
1130321690 15:82847782-82847804 AGCCTGCTGCTGGGCAGACCAGG + Intronic
1132314093 15:100878474-100878496 CGGCCTCAGCTGTGCACTCCAGG + Intronic
1132501754 16:287597-287619 AGCCGCCGGCTGTGCAGTCCTGG - Exonic
1132725869 16:1338165-1338187 CGCCTCCTGCTGTGCTGTCGCGG + Intronic
1141114539 16:81296983-81297005 CGCCTTCTGCCCAGCAGTTCAGG - Intergenic
1144968161 17:19090562-19090584 GGCCTTCTGCTGTGTGGCCCTGG - Intergenic
1144979756 17:19161501-19161523 GGCCTTCTGCTGTGTGGCCCTGG + Intergenic
1144988466 17:19216731-19216753 GGCCTTCTGCTGTGTGGCCCTGG - Intronic
1146469663 17:33113879-33113901 CCCTTTCTGCTGTGCTGTCCTGG + Intronic
1146591155 17:34128978-34129000 CTCCCTCTGCTGTGGAGCCCAGG - Intronic
1148906117 17:50913268-50913290 AGCCTTCTGATGCCCAGTCCAGG - Intergenic
1150235417 17:63589064-63589086 CTCCTTCAGCTGTGTAGGCCAGG - Exonic
1151131038 17:71896110-71896132 CACCTCCTGCTGTGCGGCCCCGG - Intergenic
1151561295 17:74871270-74871292 CCCCTTGTCCTGGGCAGTCCAGG + Intronic
1151572934 17:74936199-74936221 CGCTTTCTGCTGTGTGGACCCGG - Intronic
1152748071 17:82050329-82050351 CGCCCTCTGCTGTGCCTCCCGGG + Intronic
1154010328 18:10568693-10568715 GGTCTTCTGCTGCCCAGTCCTGG + Intergenic
1155481658 18:26295584-26295606 CACCTCTTCCTGTGCAGTCCAGG + Intronic
1155940919 18:31801233-31801255 GGCCCTCTGCTGTGCAGTTCTGG + Intergenic
1156275837 18:35581873-35581895 CGCCCGCGGCTGGGCAGTCCCGG + Intronic
1157324346 18:46657936-46657958 GGGCTTCTGGTGTGCAGCCCGGG - Intergenic
1157577733 18:48754863-48754885 GGGCTTCTGCTGTTCATTCCTGG - Intronic
1160189514 18:76703868-76703890 CTTCTTCTGCTTTCCAGTCCAGG + Intergenic
1160705253 19:526506-526528 AGCTTTCCTCTGTGCAGTCCCGG - Intergenic
1163744618 19:19037925-19037947 TGCCTCCTGCTGTGCAGCCCAGG - Intronic
1163860014 19:19737951-19737973 CCCCTTCTGCTGGGCCTTCCAGG - Intergenic
1167675063 19:50878700-50878722 TGCTTTCTGGTGTGGAGTCCAGG + Exonic
1168125647 19:54281050-54281072 CGCCTCTGGCTGTGCTGTCCAGG + Exonic
925093299 2:1172760-1172782 CGCCTTGTGCTGACCATTCCAGG + Intronic
925532826 2:4883641-4883663 GGCCCCCTGCTGTGCAGTCTCGG - Intergenic
925868335 2:8248034-8248056 CCTCTCCTGCTGTGCAGGCCAGG + Intergenic
927341579 2:21989611-21989633 CACCTCCTGCTGTGCAGACCTGG - Intergenic
932740927 2:74290752-74290774 CCCCTGCTGCTGTGGAGACCCGG - Intronic
933423120 2:82077335-82077357 CACCTCCTGCTGTGCAGTACTGG + Intergenic
933782945 2:85814383-85814405 CGCCCTCTGCTGTCCAGGCTGGG + Intergenic
937288021 2:120765324-120765346 AGCCATCGGCTGTGCAGCCCAGG - Intronic
941325740 2:164111622-164111644 CACCTCCTGCTGTGCGGCCCAGG + Intergenic
948112934 2:235471539-235471561 CGTCTTATGCTCTGCAGTGCTGG + Intergenic
948467612 2:238159752-238159774 CACCCTCTGCTCAGCAGTCCAGG - Intronic
1170833801 20:19866330-19866352 CACCTCCTGCTGTGCAGTCTTGG + Intergenic
1171392330 20:24809530-24809552 CACCTACTGCTGTGGAGCCCTGG - Intergenic
1172115920 20:32573670-32573692 CGCTTACTGCTGTGCAGTCTTGG - Intronic
1172826464 20:37791624-37791646 CACCTTCTGCTGTGCATTCTGGG - Intronic
1175695584 20:61100739-61100761 AGACTTCTGCTGTGGAGCCCGGG - Intergenic
1176167825 20:63683254-63683276 AGCCTTCTGCTGGGCAGGCATGG - Intronic
1176316127 21:5246230-5246252 AGCTTTCTGCTGTGAAGTCAAGG - Intergenic
1177146255 21:17410342-17410364 CACCTTCTGCTGTGTGGCCCAGG - Intergenic
1178344152 21:31810769-31810791 CCCCCTCTGATCTGCAGTCCTGG + Intergenic
1178380611 21:32104460-32104482 CACTTCCTGCTGTGCAGCCCTGG - Intergenic
1178926665 21:36780945-36780967 CACCTCCTGCTGTGCAGCCTGGG - Intronic
1179003307 21:37484010-37484032 CACCTCCTGCTGTGTAGCCCGGG - Intronic
1179775530 21:43659551-43659573 CGCCGCCTTCTGTGCAGTCGCGG + Exonic
1180147400 21:45929011-45929033 TGCCCTCTGCTGAGCAGCCCTGG + Intronic
1180188703 21:46152712-46152734 CGCCTGCGGCCGTGCAGGCCCGG - Intronic
1180393931 22:12312154-12312176 AGCTTTCTGCTGTGAAGTCAAGG - Intergenic
1180405816 22:12552596-12552618 AGCTTTCTGCTGTGAAGTCAAGG + Intergenic
1180460877 22:15563551-15563573 CTCCTGCTGCCCTGCAGTCCCGG + Intergenic
1180801618 22:18634580-18634602 CGCATTCTGCTGGGCCGTCCGGG - Intergenic
1180852862 22:19030119-19030141 CGCATTCTGCTGGGCCGTCCGGG - Intergenic
1181105522 22:20572510-20572532 AGCCTTGTGCTGTGCACACCTGG + Intronic
1181220104 22:21360681-21360703 CGCATTCTGCTGGGCCGTCCGGG + Intergenic
1185166884 22:49266867-49266889 GGCCCTCCGCTGTTCAGTCCTGG - Intergenic
1185203481 22:49523011-49523033 GGCCTTCAGCTGTGCTGGCCTGG - Intronic
950098339 3:10343003-10343025 CACCTGCTGCTGTGAAGTGCTGG + Intronic
950190005 3:10970072-10970094 CTCCTTCTGCTGTGGCCTCCTGG - Intergenic
950232444 3:11287966-11287988 GGCCTTTTTTTGTGCAGTCCAGG + Intronic
951264995 3:20554296-20554318 CACCTTATGCTGTGGAGTCCCGG + Intergenic
954367526 3:50154581-50154603 CGCCACCTGCTGAGCAGCCCGGG + Intergenic
955365392 3:58306148-58306170 CGCCCTCTGGTGTCCACTCCGGG - Intergenic
956043239 3:65168861-65168883 CTCCTTCTGCTGTGCTGGGCCGG - Intergenic
958781112 3:98543445-98543467 CACCTTCTGCTCTTCAGTCATGG + Intronic
959534455 3:107469647-107469669 TCCTTTCTGGTGTGCAGTCCCGG - Intergenic
961530441 3:127537086-127537108 CACCTTCTGCGGTGGAGGCCAGG - Intergenic
961629098 3:128283216-128283238 AGCTTTCTGCTGGGCTGTCCTGG - Intronic
964051203 3:152395923-152395945 CACCTCCTGCTGTGCAGCCCAGG - Intronic
964849636 3:161081321-161081343 CGCTTTCTTCTGTGCAGGCAGGG - Intergenic
965412056 3:168344513-168344535 CTCATTCTGCTTTTCAGTCCTGG + Intergenic
966802132 3:183774216-183774238 CAACTTCTGCTGTGCGGCCCAGG - Intronic
967051000 3:185784463-185784485 TGCCTCCTGCTGTGCTGTGCTGG - Intronic
969286243 4:6204157-6204179 TGACTCCTGCTGAGCAGTCCTGG + Intergenic
969568806 4:7995987-7996009 GGCCTCCTGCCTTGCAGTCCTGG + Intronic
969693761 4:8723614-8723636 GGCCTTCAGCTGTGCAGAGCAGG + Intergenic
971366508 4:25981844-25981866 CTCCTTCTGCTGGGCTCTCCAGG - Intergenic
972109635 4:35541522-35541544 CTGCCTCTGCTGTCCAGTCCAGG + Intergenic
978725032 4:111959569-111959591 CAACTTCTGCTGTGCACTCTTGG + Intergenic
979413410 4:120406496-120406518 AGCCTTCAGCTGTGCAGCCTGGG - Intergenic
985430724 4:189877124-189877146 AGCTTTCTGCTGTGAAGTCAAGG + Intergenic
986649521 5:9949487-9949509 CACCTCCTGCTGTACAGCCCAGG + Intergenic
992074467 5:73177896-73177918 TCCCTTCTGCTCTGCAGGCCAGG + Intergenic
992096278 5:73366056-73366078 TGCCTTCTGCTCTGCTCTCCTGG - Intergenic
995067500 5:107878863-107878885 AGCCTGCTGCAGTGCAGCCCAGG - Intronic
996614346 5:125422499-125422521 CACCTCCTGCTGTGCGGCCCCGG - Intergenic
996885187 5:128345483-128345505 TGCCTGCTGCTGTGCTGTCGGGG - Exonic
998116723 5:139543460-139543482 CGCCTACTGACGTGCAATCCAGG - Intronic
998368561 5:141646692-141646714 CGCCTTCTGCTCCCCACTCCAGG + Exonic
999412518 5:151364848-151364870 ATGCTTCTGCTGTGCAGTCTGGG + Intergenic
1001713459 5:173795754-173795776 GGCCTTCTGCTGCCCAGCCCTGG - Intergenic
1002368080 5:178729102-178729124 CCCCTTCTGCTTTCCAGCCCTGG + Intronic
1002385246 5:178860946-178860968 CCCCTTCTGCTTTCCAGCCCTGG - Intronic
1006549090 6:34805560-34805582 CGCCTTCTGCTGCCCAGCCTGGG - Intronic
1007075865 6:39065730-39065752 GGCCTTCAGCTGTGCAGAACCGG - Exonic
1008064099 6:47029066-47029088 CGACTGCTGCTGTTCAGTCCAGG - Exonic
1010740299 6:79495037-79495059 CACCTCCTGCTGTGCAAGCCCGG - Intronic
1018063012 6:160104999-160105021 TGTCTTCTGCTGTGCAGAGCTGG - Exonic
1018289962 6:162282073-162282095 CACCCCCTGCTGTGCAGCCCAGG + Intronic
1018887429 6:167951742-167951764 CTTCATCTGCTGTGCAGTCAGGG - Exonic
1019087882 6:169499252-169499274 AGCCTTCTGCTGTGCACCCTCGG - Intronic
1019567425 7:1691348-1691370 CACCTTCTGCTCTGCAGCCTTGG + Intronic
1019801965 7:3094508-3094530 CTCCTTCTGGTTTCCAGTCCCGG - Intergenic
1019901678 7:4025998-4026020 CGCCTTCTGGGCTGCAGTCCCGG - Intronic
1020084337 7:5302591-5302613 GGCCATCTGCTATGCACTCCAGG - Intronic
1024517329 7:50269896-50269918 TGCCTTCTGCAGTGCCGGCCTGG - Intergenic
1024761532 7:52602721-52602743 CACCTCCTGCTGTGCCGCCCAGG - Intergenic
1025209953 7:57014608-57014630 GGCCATCTGCTATGCACTCCAGG + Intergenic
1025661998 7:63562243-63562265 GGCCATCTGCTATGCACTCCAGG - Intergenic
1026053495 7:66966036-66966058 CACCTCCTGCTGTGCAGCCTGGG + Intergenic
1028641923 7:93051858-93051880 CACCTTCTGCTGTGTGGCCCAGG + Intergenic
1029232052 7:99078532-99078554 CACCTCCTGCTGTGCAGCCTGGG - Intronic
1029287617 7:99476841-99476863 CACCTACTGCTGTACACTCCAGG + Intronic
1030520160 7:110588686-110588708 TGCTTCCTGCTGTGCAGTCTTGG - Intergenic
1034226364 7:149486957-149486979 CACCCCCTGCTGTGCAGTCCAGG - Intronic
1034254091 7:149714950-149714972 CGCCTTCTCCTGCGCGGACCTGG + Intronic
1034932374 7:155172696-155172718 CTCTTTCTTCTGTGCTGTCCTGG - Intergenic
1035277893 7:157758774-157758796 GGCCTTCTGCTGTGCAGCAAGGG - Intronic
1044995667 8:97835856-97835878 CACCTCCTGCTGTGCAGCCCGGG - Intronic
1047327506 8:123853896-123853918 CACCTTCTGCTGCCCTGTCCAGG - Intronic
1048260798 8:132943563-132943585 TGCCTTCTGCTGGGGAGCCCTGG - Intronic
1049014926 8:139913640-139913662 TGCCTTCTCCTCTGCAGCCCTGG + Intronic
1049656856 8:143802816-143802838 GGGCTTCTGCTCTGGAGTCCAGG + Intronic
1051572367 9:18574026-18574048 CTGCTTCTGGTGGGCAGTCCTGG - Exonic
1052720897 9:32169882-32169904 CGTCTTCCTCTGTGTAGTCCTGG - Intergenic
1052913499 9:33905576-33905598 CACCTCCTTCTGTGCAGTGCTGG - Intronic
1053720024 9:40936023-40936045 AGCTTTCTGCTGTGAAGTCAAGG + Intergenic
1055307427 9:74944110-74944132 CACCTCCTGCTGTGCATCCCGGG - Intergenic
1055767856 9:79684346-79684368 CACCTCCTGCTGTGCAGCCTGGG - Intronic
1057146784 9:92764237-92764259 CGCCTGCTTCTGTGCGGACCTGG - Intronic
1059078123 9:111216874-111216896 CCCCCTCTGCTCTGCAGTCCTGG + Intergenic
1060407898 9:123381835-123381857 GGCCTCCTGCTGTCCAGTGCTGG - Exonic
1061425489 9:130495766-130495788 CGCCTGCTGCTATCTAGTCCAGG - Intronic
1061861449 9:133470557-133470579 AGTCTGCAGCTGTGCAGTCCTGG + Exonic
1062464901 9:136676590-136676612 CGCCTTCTACCTGGCAGTCCAGG - Exonic
1198733336 X:139758445-139758467 CACCTCCTGCTGTGCAGCCTCGG - Intronic
1202043500 Y:20712793-20712815 GGTCATCTGCTGTGCATTCCTGG - Intergenic