ID: 1110711799

View in Genome Browser
Species Human (GRCh38)
Location 13:78658690-78658712
Sequence CTTCCCTCTGCAGCCTCGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 2, 3: 64, 4: 271}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110711799_1110711804 9 Left 1110711799 13:78658690-78658712 CCACGCGAGGCTGCAGAGGGAAG 0: 1
1: 0
2: 2
3: 64
4: 271
Right 1110711804 13:78658722-78658744 CCTGCGATGCGTTTCTGATGGGG 0: 1
1: 0
2: 0
3: 3
4: 67
1110711799_1110711800 7 Left 1110711799 13:78658690-78658712 CCACGCGAGGCTGCAGAGGGAAG 0: 1
1: 0
2: 2
3: 64
4: 271
Right 1110711800 13:78658720-78658742 TCCCTGCGATGCGTTTCTGATGG 0: 1
1: 0
2: 0
3: 1
4: 56
1110711799_1110711806 25 Left 1110711799 13:78658690-78658712 CCACGCGAGGCTGCAGAGGGAAG 0: 1
1: 0
2: 2
3: 64
4: 271
Right 1110711806 13:78658738-78658760 GATGGGGCCTCCTTCGAGGCCGG 0: 1
1: 0
2: 1
3: 11
4: 132
1110711799_1110711802 8 Left 1110711799 13:78658690-78658712 CCACGCGAGGCTGCAGAGGGAAG 0: 1
1: 0
2: 2
3: 64
4: 271
Right 1110711802 13:78658721-78658743 CCCTGCGATGCGTTTCTGATGGG 0: 1
1: 0
2: 1
3: 3
4: 43
1110711799_1110711805 21 Left 1110711799 13:78658690-78658712 CCACGCGAGGCTGCAGAGGGAAG 0: 1
1: 0
2: 2
3: 64
4: 271
Right 1110711805 13:78658734-78658756 TTCTGATGGGGCCTCCTTCGAGG 0: 1
1: 0
2: 2
3: 12
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110711799 Original CRISPR CTTCCCTCTGCAGCCTCGCG TGG (reversed) Intronic