ID: 1110716763

View in Genome Browser
Species Human (GRCh38)
Location 13:78714527-78714549
Sequence AAGTGGTAGTAGAGGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110716755_1110716763 19 Left 1110716755 13:78714485-78714507 CCAGCCTCTATGATCTTTTGCTG No data
Right 1110716763 13:78714527-78714549 AAGTGGTAGTAGAGGGAGGTGGG No data
1110716756_1110716763 15 Left 1110716756 13:78714489-78714511 CCTCTATGATCTTTTGCTGAATT No data
Right 1110716763 13:78714527-78714549 AAGTGGTAGTAGAGGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110716763 Original CRISPR AAGTGGTAGTAGAGGGAGGT GGG Intergenic
No off target data available for this crispr