ID: 1110718758

View in Genome Browser
Species Human (GRCh38)
Location 13:78737930-78737952
Sequence CAAAATTTAGGGATGGGAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110718758_1110718765 2 Left 1110718758 13:78737930-78737952 CCCGCTCCCATCCCTAAATTTTG No data
Right 1110718765 13:78737955-78737977 AAAAAGAAACAGTAATCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110718758 Original CRISPR CAAAATTTAGGGATGGGAGC GGG (reversed) Intergenic
No off target data available for this crispr