ID: 1110720482

View in Genome Browser
Species Human (GRCh38)
Location 13:78755614-78755636
Sequence CCACATATACTGAAAGTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110720482_1110720487 -1 Left 1110720482 13:78755614-78755636 CCTACTACTTTCAGTATATGTGG No data
Right 1110720487 13:78755636-78755658 GGGGTCTTTGAGAAGATGATAGG No data
1110720482_1110720488 18 Left 1110720482 13:78755614-78755636 CCTACTACTTTCAGTATATGTGG No data
Right 1110720488 13:78755655-78755677 TAGGAAAATAAAAAGATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110720482 Original CRISPR CCACATATACTGAAAGTAGT AGG (reversed) Intergenic
No off target data available for this crispr