ID: 1110720487 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:78755636-78755658 |
Sequence | GGGGTCTTTGAGAAGATGAT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1110720480_1110720487 | 3 | Left | 1110720480 | 13:78755610-78755632 | CCCTCCTACTACTTTCAGTATAT | No data | ||
Right | 1110720487 | 13:78755636-78755658 | GGGGTCTTTGAGAAGATGATAGG | No data | ||||
1110720481_1110720487 | 2 | Left | 1110720481 | 13:78755611-78755633 | CCTCCTACTACTTTCAGTATATG | No data | ||
Right | 1110720487 | 13:78755636-78755658 | GGGGTCTTTGAGAAGATGATAGG | No data | ||||
1110720482_1110720487 | -1 | Left | 1110720482 | 13:78755614-78755636 | CCTACTACTTTCAGTATATGTGG | No data | ||
Right | 1110720487 | 13:78755636-78755658 | GGGGTCTTTGAGAAGATGATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1110720487 | Original CRISPR | GGGGTCTTTGAGAAGATGAT AGG | Intergenic | ||
No off target data available for this crispr |