ID: 1110720488

View in Genome Browser
Species Human (GRCh38)
Location 13:78755655-78755677
Sequence TAGGAAAATAAAAAGATGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110720481_1110720488 21 Left 1110720481 13:78755611-78755633 CCTCCTACTACTTTCAGTATATG No data
Right 1110720488 13:78755655-78755677 TAGGAAAATAAAAAGATGTGAGG No data
1110720482_1110720488 18 Left 1110720482 13:78755614-78755636 CCTACTACTTTCAGTATATGTGG No data
Right 1110720488 13:78755655-78755677 TAGGAAAATAAAAAGATGTGAGG No data
1110720480_1110720488 22 Left 1110720480 13:78755610-78755632 CCCTCCTACTACTTTCAGTATAT No data
Right 1110720488 13:78755655-78755677 TAGGAAAATAAAAAGATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110720488 Original CRISPR TAGGAAAATAAAAAGATGTG AGG Intergenic
No off target data available for this crispr