ID: 1110725389

View in Genome Browser
Species Human (GRCh38)
Location 13:78816907-78816929
Sequence GCTGCTCTCTGAACAGTCAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110725389_1110725396 1 Left 1110725389 13:78816907-78816929 CCGGTGACTGTTCAGAGAGCAGC No data
Right 1110725396 13:78816931-78816953 ACAGGACGGGCCTGTTGGCTGGG No data
1110725389_1110725393 -4 Left 1110725389 13:78816907-78816929 CCGGTGACTGTTCAGAGAGCAGC No data
Right 1110725393 13:78816926-78816948 CAGCCACAGGACGGGCCTGTTGG No data
1110725389_1110725395 0 Left 1110725389 13:78816907-78816929 CCGGTGACTGTTCAGAGAGCAGC No data
Right 1110725395 13:78816930-78816952 CACAGGACGGGCCTGTTGGCTGG No data
1110725389_1110725399 7 Left 1110725389 13:78816907-78816929 CCGGTGACTGTTCAGAGAGCAGC No data
Right 1110725399 13:78816937-78816959 CGGGCCTGTTGGCTGGGGCAGGG No data
1110725389_1110725397 2 Left 1110725389 13:78816907-78816929 CCGGTGACTGTTCAGAGAGCAGC No data
Right 1110725397 13:78816932-78816954 CAGGACGGGCCTGTTGGCTGGGG No data
1110725389_1110725401 12 Left 1110725389 13:78816907-78816929 CCGGTGACTGTTCAGAGAGCAGC No data
Right 1110725401 13:78816942-78816964 CTGTTGGCTGGGGCAGGGAGCGG No data
1110725389_1110725402 13 Left 1110725389 13:78816907-78816929 CCGGTGACTGTTCAGAGAGCAGC No data
Right 1110725402 13:78816943-78816965 TGTTGGCTGGGGCAGGGAGCGGG No data
1110725389_1110725398 6 Left 1110725389 13:78816907-78816929 CCGGTGACTGTTCAGAGAGCAGC No data
Right 1110725398 13:78816936-78816958 ACGGGCCTGTTGGCTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110725389 Original CRISPR GCTGCTCTCTGAACAGTCAC CGG (reversed) Intergenic
No off target data available for this crispr