ID: 1110725394

View in Genome Browser
Species Human (GRCh38)
Location 13:78816929-78816951
Sequence CAGCCAACAGGCCCGTCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110725394_1110725401 -10 Left 1110725394 13:78816929-78816951 CCACAGGACGGGCCTGTTGGCTG No data
Right 1110725401 13:78816942-78816964 CTGTTGGCTGGGGCAGGGAGCGG No data
1110725394_1110725402 -9 Left 1110725394 13:78816929-78816951 CCACAGGACGGGCCTGTTGGCTG No data
Right 1110725402 13:78816943-78816965 TGTTGGCTGGGGCAGGGAGCGGG No data
1110725394_1110725404 16 Left 1110725394 13:78816929-78816951 CCACAGGACGGGCCTGTTGGCTG No data
Right 1110725404 13:78816968-78816990 CATTAATCACAATGTTCCCTGGG No data
1110725394_1110725405 23 Left 1110725394 13:78816929-78816951 CCACAGGACGGGCCTGTTGGCTG No data
Right 1110725405 13:78816975-78816997 CACAATGTTCCCTGGGCTAATGG No data
1110725394_1110725406 24 Left 1110725394 13:78816929-78816951 CCACAGGACGGGCCTGTTGGCTG No data
Right 1110725406 13:78816976-78816998 ACAATGTTCCCTGGGCTAATGGG No data
1110725394_1110725403 15 Left 1110725394 13:78816929-78816951 CCACAGGACGGGCCTGTTGGCTG No data
Right 1110725403 13:78816967-78816989 GCATTAATCACAATGTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110725394 Original CRISPR CAGCCAACAGGCCCGTCCTG TGG (reversed) Intergenic
No off target data available for this crispr