ID: 1110725401

View in Genome Browser
Species Human (GRCh38)
Location 13:78816942-78816964
Sequence CTGTTGGCTGGGGCAGGGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110725394_1110725401 -10 Left 1110725394 13:78816929-78816951 CCACAGGACGGGCCTGTTGGCTG No data
Right 1110725401 13:78816942-78816964 CTGTTGGCTGGGGCAGGGAGCGG No data
1110725389_1110725401 12 Left 1110725389 13:78816907-78816929 CCGGTGACTGTTCAGAGAGCAGC No data
Right 1110725401 13:78816942-78816964 CTGTTGGCTGGGGCAGGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110725401 Original CRISPR CTGTTGGCTGGGGCAGGGAG CGG Intergenic
No off target data available for this crispr