ID: 1110725403

View in Genome Browser
Species Human (GRCh38)
Location 13:78816967-78816989
Sequence GCATTAATCACAATGTTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110725400_1110725403 3 Left 1110725400 13:78816941-78816963 CCTGTTGGCTGGGGCAGGGAGCG No data
Right 1110725403 13:78816967-78816989 GCATTAATCACAATGTTCCCTGG No data
1110725394_1110725403 15 Left 1110725394 13:78816929-78816951 CCACAGGACGGGCCTGTTGGCTG No data
Right 1110725403 13:78816967-78816989 GCATTAATCACAATGTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110725403 Original CRISPR GCATTAATCACAATGTTCCC TGG Intergenic
No off target data available for this crispr