ID: 1110735448

View in Genome Browser
Species Human (GRCh38)
Location 13:78930365-78930387
Sequence CCTTATTTATGGTGTACTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1110735438_1110735448 8 Left 1110735438 13:78930334-78930356 CCTCTTCTTGGGGGACACTAATA No data
Right 1110735448 13:78930365-78930387 CCTTATTTATGGTGTACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1110735448 Original CRISPR CCTTATTTATGGTGTACTGG GGG Intergenic
No off target data available for this crispr